KEGG   Homo sapiens (human): 199800
Entry
199800            CDS       T01001                                 

Gene name
ADM5, AM5, C19orf76
Definition
(RefSeq) adrenomedullin 5 (putative)
Organism
hsa  Homo sapiens (human)
SSDB
Other DBs
NCBI-GeneID: 199800
NCBI-ProteinID: NP_001094810
HGNC: 27293
Ensembl: ENSG00000224420
Vega: OTTHUMG00000183240
Pharos: C9JUS6(Tdark)
UniProt: C9JUS6
Position
19q13.33
AA seq 153 aa
MTIHILILLLLLAFSAQGDLDTAARRGQHQVPQHRGHVCYLGVCRTHRLAEIIYWIRCLH
QGALGEGQPRAPGPLQLWAPPVARGGSPARFPGFRPAARGLAQCPARWVTSGTARPLLGF
SLPICMLELLLHISSPLTPAPETVFPSPSPGCD
NT seq 462 nt   +upstreamnt  +downstreamnt
atgactatccacatcctcatcctgctgttgctcctcgccttctccgcccaaggggacctg
gacactgcagccaggcgaggccagcaccaggtcccccagcaccgcgggcacgtctgctac
ctgggcgtatgccggacccaccgcctggcggagatcatatactggattcgctgtctccac
caaggagccctcggggaaggccagccacgagccccaggacccctacagctatgggcgccg
ccggtggcgcgaggcggaagcccggctcggttcccaggattccggcctgcagcgaggggg
ctagcgcagtgcccagctcgctgggtgacctcgggcacggctcgtcccctcctcggcttc
agtttgcctatctgtatgttggagcttctactccacatttcttctcccctaactccagcc
cctgaaaccgtcttccccagtccctccccgggctgcgactag

DBGET integrated database retrieval system