KEGG   Homo sapiens (human): 23300
Entry
23300             CDS       T01001                                 

Gene name
ATMIN, ASCIZ, ZNF822
Definition
(RefSeq) ATM interactor
Organism
hsa  Homo sapiens (human)
SSDB
Other DBs
NCBI-GeneID: 23300
NCBI-ProteinID: NP_056066
OMIM: 614693
HGNC: 29034
Ensembl: ENSG00000166454
Vega: OTTHUMG00000176469
Pharos: O43313(Tbio)
UniProt: O43313
Position
16q23.2
AA seq 823 aa
MAASEAAAAAGSAALAAGARAVPAATTGAAAAASGPWVPPGPRLRGSRPRPAGATQQPAV
PAPPAGELIQPSVSELSRAVRTNILCTVRGCGKILPNSPALNMHLVKSHRLQDGIVNPTI
RKDLKTGPKFYCCPIEGCPRGPERPFSQFSLVKQHFMKMHAEKKHKCSKCSNSYGTEWDL
KRHAEDCGKTFRCTCGCPYASRTALQSHIYRTGHEIPAEHRDPPSKKRKMENCAQNQKLS
NKTIESLNNQPIPRPDTQELEASEIKLEPSFEDSCGSNTDKQTLTTPPRYPQKLLLPKPK
VALVKLPVMQFSVMPVFVPTADSSAQPVVLGVDQGSATGAVHLMPLSVGTLILGLDSEAC
SLKESLPLFKIANPIAGEPISTGVQVNFGKSPSNPLQELGNTCQKNSISSINVQTDLSYA
SQNFIPSAQWATADSSVSSCSQTDLSFDSQVSLPISVHTQTFLPSSKVTSSIAAQTDAFM
DTCFQSGGVSRETQTSGIESPTDDHVQMDQAGMCGDIFESVHSSYNVATGNIISNSLVAE
TVTHSLLPQNEPKTLNQDIEKSAPIINFSAQNSMLPSQNMTDNQTQTIDLLSDLENILSS
NLPAQTLDHRSLLSDTNPGPDTQLPSGPAQNPGIDFDIEEFFSASNIQTQTEESELSTMT
TEPVLESLDIETQTDFLLADTSAQSYGCRGNSNFLGLEMFDTQTQTDLNFFLDSSPHLPL
GSILKHSSFSVSTDSSDTETQTEGVSTAKNIPALESKVQLNSTETQTMSSGFETLGSLFF
TSNETQTAMDDFLLADLAWNTMESQFSSVETQTSAEPHTVSNF
NT seq 2472 nt   +upstreamnt  +downstreamnt
atggcggcctcggaggcggcggcggcggcggggtccgcggctctggcggcgggtgcccgg
gccgtcccggcggccacgacaggagccgccgccgccgcctcgggcccgtgggtgcccccg
ggaccccgactgaggggcagccggccgcggcccgcgggggcgacgcagcagcccgctgtc
cccgcgccgccggcgggggagctgatccagccgtcggtgagcgagctgtcccgggccgtg
cggaccaacatcctgtgcaccgtgcgcggctgcggcaagatcctgcccaacagccccgcg
ctcaacatgcacctagtcaagagccaccgcctgcaggatggcatagtcaatccaacaata
agaaaagatttgaaaactggaccgaaattctactgctgtccaattgaaggctgccccaga
ggccctgagagaccgttttctcagttttctctcgtaaaacagcactttatgaaaatgcat
gctgagaagaagcacaaatgtagtaagtgcagcaattcgtacggtacagaatgggacctg
aaaagacatgcagaggactgtggcaagaccttccggtgcacatgcggctgtccctacgcc
agtagaacagcactgcagtctcacatctaccgaactgggcacgagatacctgcagaacac
agggacccacctagtaagaaaaggaaaatggaaaactgtgcacaaaaccagaagttatcc
aacaagaccattgaatcattgaacaaccaaccaatccctagaccagacactcaagaacta
gaagcttcagaaataaagctagaaccatcttttgaagactcttgtggctctaacactgac
aagcagactcttacaacaccaccgagatatcctcagaagttgcttttaccaaagcccaaa
gtggctttggttaaactacccgtgatgcagttttctgtcatgcctgtctttgtgcctaca
gccgactcctcagcccagcctgtggtgttaggtgttgatcagggctctgccacaggggct
gtgcacttaatgcccttgtcagtaggaaccctgatcctcggcctagattcagaggcttgc
tctcttaaggagagcctacctcttttcaaaattgctaatcctattgctggtgagccaata
agtactggtgttcaagtgaactttggtaaaagtccatctaatcctttacaagaactaggg
aacacgtgtcaaaagaatagcatttcttcaatcaacgtgcagacagatctgtcttatgcc
tcacaaaactttataccttctgcacagtgggccactgctgattcctctgtgtcgtcttgt
tctcaaactgatttgtcgtttgattctcaagtgtctcttcccattagtgttcacactcag
acatttttgcccagctctaaggtaacttcatctatagctgctcagactgatgcatttatg
gacacctgtttccagtcaggtggggtctccagagaaactcaaaccagtgggatagaaagt
ccaacggatgaccatgtacagatggaccaagctggaatgtgcggagacatttttgagagt
gttcattcatcatataatgttgctacaggtaacattataagcaacagtttagtagcagag
acagtaactcatagtttgttacctcagaatgagcctaagactttaaatcaagatattgag
aaatctgcaccaattataaatttcagtgcacagaatagtatgcttccttcacagaacatg
acagataatcagacccaaaccatagatttattaagtgatttggaaaacatcttgtcaagt
aatctgcctgctcagacattggatcatcgtagtcttttgtctgacacaaatcctggacct
gacacccagctcccatctggcccagcccagaaccccggaatcgattttgatatcgaagag
ttcttttcggcctcaaatatccagactcaaactgaagagagtgaacttagcaccatgacc
accgagccagtcttggagtcactggacatagagactcaaacggacttcttactcgcagat
acctctgctcagtcctatgggtgtaggggaaattctaacttcttaggccttgagatgttt
gacacacagacacagacagacttaaactttttcttagacagtagccctcatctgcctctg
ggaagtattctgaaacactccagcttttccgtgagtactgattcatctgacacagagacc
caaactgaaggagtctccactgctaaaaatatacctgctctagaaagcaaagttcagttg
aacagtacagaaacacagaccatgagttctgggtttgaaaccctggggagcttgttcttc
accagcaacgaaactcagacagcaatggatgactttcttctggctgatctggcctggaac
acgatggagtctcagttcagctctgtagaaacccagacttctgcggaaccacacacagtc
tccaacttctaa

DBGET integrated database retrieval system