KEGG   Homo sapiens (human): 2646Help
Entry
2646              CDS       T01001                                 

Gene name
GCKR, FGQTL5, GKRP
Definition
(RefSeq) glucokinase regulator
Organism
hsa  Homo sapiens (human)
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 2646
NCBI-ProteinID: NP_001477
OMIM: 600842
HGNC: 4196
Ensembl: ENSG00000084734
Vega: OTTHUMG00000128426
Pharos: Q14397(Tchem)
UniProt: Q14397 A0A0C4DFN2
Structure
PDB: 

Position
2p23.3
AA seq 625 aa AA seqDB search
MPGTKRFQHVIETPEPGKWELSGYEAAVPITEKSNPLTQDLDKADAENIVRLLGQCDAEI
FQEEGQALSTYQRLYSESILTTMVQVAGKVQEVLKEPDGGLVVLSGGGTSGRMAFLMSVS
FNQLMKGLGQKPLYTYLIAGGDRSVVASREGTEDSALHGIEELKKVAAGKKRVIVIGISV
GLSAPFVAGQMDCCMNNTAVFLPVLVGFNPVSMARNDPIEDWSSTFRQVAERMQKMQEKQ
KAFVLNPAIGPEGLSGSSRMKGGSATKILLETLLLAAHKTVDQGIAASQRCLLEILRTFE
RAHQVTYSQSPKIATLMKSVSTSLEKKGHVYLVGWQTLGIIAIMDGVECIHTFGADFRDV
RGFLIGDHSDMFNQKAELTNQGPQFTFSQEDFLTSILPSLTEIDTVVFIFTLDDNLTEVQ
TIVEQVKEKTNHIQALAHSTVGQTLLIPLKKLFPSIISITWPLLFFEYEGNFIQKFQREL
STKWVLNTVSTGAHVLLGKILQNHMLDLRISNSKLFWRALAMLQRFSGQSKARCIESLLR
AIHFPQPLSDDIRAAPISCHVQVAHEKEQVIPIALLSLLFRCSITEAQAHLAAAPSVCEA
VRSALAGPGQKRTADPLEILEPDVQ
NT seq 1878 nt NT seq  +upstreamnt  +downstreamnt
atgccaggcacaaaacggtttcaacatgtcattgagaccccggagcctggcaagtgggag
ttgtctgggtacgaggcagctgtgccaatcacggagaagtcaaacccactgacccaggat
ctagacaaagcagatgctgagaacattgttcgactgctagggcaatgtgatgctgagatc
ttccaggaggaggggcaagccctgtccacataccagagactctacagcgaatccattctg
accaccatggtacaggtggctgggaaagttcaggaagtgctgaaggagccagatgggggg
ctggttgtgctgagtggagggggcacctctggccggatggcattcctcatgtcggtgtcc
tttaatcagctgatgaaaggtctgggacagaaacctctttacacctacctcattgcaggt
ggtgacaggtctgtggtggcctctagggaggggacagaagatagtgccttgcacgggatt
gaggaactgaagaaggtggctgccgggaagaagagagtgattgtcattggcatttctgtg
ggactctctgctccctttgtggcaggccagatggactgctgcatgaacaacacagctgtc
ttcttgccagtcctggttggcttcaatccagtgagcatggccagaaatgaccccattgaa
gactggagttcaacattccgacaagtagcagagcggatgcagaaaatgcaggagaaacag
aaagcttttgtgctcaatcctgccatcgggcccgagggtctcagcggctcctcccggatg
aaaggtggaagtgccaccaagattctgctggaaaccctgttattagcagcccataagact
gtggaccagggcattgcagcatctcaaagatgcctcctggaaatcttgcggacatttgag
cgagctcatcaggtgacctacagccaaagccccaagattgccaccctgatgaagagtgtc
agcaccagtctggagaagaaaggccacgtgtacctggttggctggcagaccctgggcatc
attgccatcatggatggagtagagtgcatccacacctttggtgctgatttccgagatgtc
cgtggctttctcattggtgatcacagtgacatgtttaaccagaaggctgagctcaccaac
cagggtccccagttcaccttctcccaggaggacttcctgacttccatccttccctctctc
acggaaatcgatactgtggtcttcattttcaccctggatgacaacctcacggaggtgcag
actatagtggagcaggtgaaagagaagaccaaccacatccaggccctggcacacagcacc
gtgggtcagaccttgctgatccctctgaagaagctctttccctccatcatcagcatcaca
tggccactgcttttctttgaatatgaagggaacttcatccagaagttccagcgtgagcta
agcaccaaatgggtgctgaatacagtgagtacaggtgctcatgtgcttcttggtaagatc
ctacaaaaccacatgttggaccttcggattagcaactccaagctcttctggcgggcgctg
gccatgctgcagcggttctctggacagtccaaggctcgatgcatcgagagcctcctccga
gcgatccactttccccagccactgtcagatgatattcgggctgctcccatctcctgccat
gtccaggttgcacatgagaaggaacaggtgatacccatcgccttgctgagcctcctattc
cggtgctcgatcactgaggctcaggcacacctggctgcagctccttctgtctgtgaggct
gtcaggagtgctcttgctgggccaggtcagaagcgcactgcggaccccctcgagatccta
gagcctgacgttcagtga

DBGET integrated database retrieval system