KEGG   Homo sapiens (human): 27113Help
Entry
27113             CDS       T01001                                 

Gene name
BBC3, JFY-1, JFY1, PUMA
Definition
(RefSeq) BCL2 binding component 3
  KO
K10132  Bcl-2-binding component 3
Organism
hsa  Homo sapiens (human)
Pathway
hsa01524  Platinum drug resistance
hsa04115  p53 signaling pathway
hsa04210  Apoptosis
hsa04215  Apoptosis - multiple species
hsa04390  Hippo signaling pathway
hsa05016  Huntington disease
hsa05162  Measles
hsa05200  Pathways in cancer
hsa05210  Colorectal cancer
Network
nt06131  Apoptosis (virus)
nt06161  Human immunodeficiency virus type 1 (HIV-1)
nt06165  Epstein-Barr virus (EBV)
nt06166  Human papillomavirus (HPV)
nt06168  Herpes simplex virus 1 (HSV-1)
nt06169  Measles virus (MV)
nt06170  Influenza A virus (IAV)
nt06231  Apoptosis
nt06260  Colorectal cancer
nt06267  Small cell lung cancer
  Element
N00098  Intrinsic apoptotic pathway
N00695  MV V to p73-mediated transcription
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09130 Environmental Information Processing
  09132 Signal transduction
   04390 Hippo signaling pathway
    27113 (BBC3)
 09140 Cellular Processes
  09143 Cell growth and death
   04210 Apoptosis
    27113 (BBC3)
   04215 Apoptosis - multiple species
    27113 (BBC3)
   04115 p53 signaling pathway
    27113 (BBC3)
 09160 Human Diseases
  09161 Cancer: overview
   05200 Pathways in cancer
    27113 (BBC3)
  09162 Cancer: specific types
   05210 Colorectal cancer
    27113 (BBC3)
  09164 Neurodegenerative disease
   05016 Huntington disease
    27113 (BBC3)
  09172 Infectious disease: viral
   05162 Measles
    27113 (BBC3)
  09176 Drug resistance: antineoplastic
   01524 Platinum drug resistance
    27113 (BBC3)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 27113
NCBI-ProteinID: NP_001120712
OMIM: 605854
HGNC: 17868
Ensembl: ENSG00000105327
Vega: OTTHUMG00000183489
Pharos: Q9BXH1(Tbio)
UniProt: Q96PG8 Q9BXH1
Position
19q13.32
AA seq 261 aa AA seqDB search
MKFGMGSAQACPCQVPRAASTTWVPCQICGPRERHGPRTPGGQLPGARRGPGPRRPAPLP
ARPPGALGSVLRPLRARPGCRPRRPHPAARCLPLRPHRPTRRHRRPGGFPLAWGSPQPAP
RPAPGRSSALALAGGAAPGVARAQRPGGSGGRSHPGGPGSPRGGGTVGPGDRGPAAADGG
RPQRTVRAAETRGAAAAPPLTLEGPVQSHHGTPALTQGPQSPRDGAQLGACTRPVDVRDS
GGRPLPPPDTLASAGDFLCTM
NT seq 786 nt NT seq  +upstreamnt  +downstreamnt
atgaaatttggcatggggtctgcccaggcatgtccatgccaggtgcccagggctgcttcc
acgacgtgggtcccctgccagatttgtggccccagggagcgccatggcccgcgcacgcca
ggagggcagctccccggagcccgtagagggcctggcccgcgacggcccgcgccccttccc
gctcggccgcctggtgccctcggcagtgtcctgcggcctctgcgagcccggcctggctgc
cgcccccgccgcccccaccctgctgcccgctgcctacctctgcgcccccaccgccccacc
cgccgtcaccgccgccctggggggttcccgctggcctgggggtccccgcagccggccccg
aggcccgcgcccggacggtcctcagccctcgctctcgctggcggagcagcacctggagtc
gcccgtgcccagcgccccgggggctctggcgggcggtcccacccaggcggccccgggagt
ccgcggggaggaggaacagtgggcccgggagatcggggcccagctgcggcggatggcgga
cgacctcaacgcacagtacgagcggcggagacaagaggagcagcagcggcaccgcccctc
accctggagggtcctgtacaatctcatcatgggactcctgcccttacccaggggccacag
agcccccgagatggagcccaattaggtgcctgcacccgcccggtggacgtcagggactcg
gggggcaggcccctcccacctcctgacaccctggccagcgcgggggactttctctgcacc
atgtag

DBGET integrated database retrieval system