KEGG   Homo sapiens (human): 284648Help
Entry
284648            lncRNA    T01001                                 

Gene name
LINC01686
Definition
(RefSeq) long intergenic non-protein coding RNA 1686
Organism
hsa  Homo sapiens (human)
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 284648
HGNC: 27643
Ensembl: ENSG00000261504
Position
1q25.3
NT seq 1504 nt NT seq  +upstreamnt  +downstreamnt
cggccgcggagcagcgaacgcgtgcctgccagggaaaagcagtcaccaggaacgcggcgt
tttggtcggctgcccatcgccagccctgtccgcgcgagatgccctgctccgaagctcttg
tgagctccgcggcctgcggctccggaaggcgaagctcttccaggaagcagcggcggcccc
actggccctctcaggctgcggagaaagggcgggaggccgcggggctctccaggactcagt
ggtttcggagaaactcgacttcccaggctcggagggccagtttgggattgttatagaaca
aaacgtgggcggcataaagtgctccgaagtggagatcaccttgaagactgggcccttggc
tctgtgacccagcagacccgaaattccaatctggcaaactttcagcctgacccttgggaa
aggatcgctcccagagtgtgggggtggaggtgatgggacaaagatcttaaaatcctgaaa
aacaaccgttattctcaactgaatttctgctaagtgcatccattcataaacagtacgtgc
ctggcgctctttacgtgtattaactggtttaattcccacaaccttaagtaggggctgtta
atctcacaattgtagagccaccattcaaagccaggcagtctggccccagcctctgtgggc
ttaaccactacccgccgccaagcagctcctaggagcctggcagggaaaggcatggtgacg
acagcagacgaggtccctcaagtagcttgcattctggaagcgaagaaagatcatgaacaa
gtttcaaattggtaaaataattgtcagtggagattcatcccataaaggaattgagtaaaa
ggaagaactactttcagtaagatggtttgggttggagtttctgttcataagggcagaaat
ggactctctctgacttaaagagaaaaaactttgttaagagtttggggtaacccacagaat
tatcaggatgtctcagaatacagacaagaacaaagggaggctccgcagccaaaagtccct
cctctaaaccactttgatgaggaccaaacaggtgctactgctgaaagctagacaccacat
cctactccacaaccaacgctggaactccccagacaccccgctggctctgccgcccctaaa
ccggatgcggcagccaccgcggaccccacagcggattctccaccaccccatttctttgca
ttgcatcaccacctccagagtgtgcctaattggcaccccgctgcttctgatgcaaaactc
caagctgtactgggcaaacgcgcagcctctggcaccattcccagtgctgctgagcataca
gacctgagcacagcggagggggagggcttggtggggagggggacttacaattcatccacg
ctgttgaaatcccatcaaacacacacgacccagtttggctggtgcagccttttctctccc
ctcctgatagcatttcagcctctcttccaataaaaaatagtagctactaaaaaaaaaaaa
aaaa

DBGET integrated database retrieval system