KEGG   Homo sapiens (human): 337967
Entry
337967            CDS       T01001                                 

Gene name
KRTAP6-2, KAP6.2
Definition
(RefSeq) keratin associated protein 6-2
Organism
hsa  Homo sapiens (human)
SSDB
Motif
Pfam: KRTAP
Other DBs
NCBI-GeneID: 337967
NCBI-ProteinID: NP_853635
HGNC: 18932
Ensembl: ENSG00000186930
Vega: OTTHUMG00000057794
Pharos: Q3LI66(Tdark)
UniProt: Q3LI66
Position
21q22.11
AA seq 62 aa
MCGSYYGNYYGDHGYGCCGYEGLGYGYGSLRCGYSSCCGYGHGYGSRFFCGCGYGCGSGY
YY
NT seq 189 nt   +upstreamnt  +downstreamnt
atgtgcggcagctactacggaaactactacggcgaccatggctatgggtgctgtggatac
gaaggcctaggctatggctatggaagcctgcgctgtggctatagctcctgctgtggctat
ggtcatggctacggctcccgcttcttctgtggctgtggctatggatgcggctctggctac
tactattga

DBGET integrated database retrieval system