KEGG   Homo sapiens (human): 337970Help
Entry
337970            CDS       T01001                                 

Gene name
KRTAP19-3, GTRHP, KAP19.3
Definition
(RefSeq) keratin associated protein 19-3
Organism
hsa  Homo sapiens (human)
SSDB OrthologParalogGFIT
Motif
Pfam: KRTAP
Motif
Other DBs
NCBI-GeneID: 337970
NCBI-ProteinID: NP_853640
HGNC: 18938
Ensembl: ENSG00000244025
Vega: OTTHUMG00000057782
Pharos: Q7Z4W3(Tdark)
UniProt: Q7Z4W3
Position
21q22.11
AA seq 81 aa AA seqDB search
MSYYGSYYGGLGYGCGGFGGLGYGYGCGCGSFRRLGSGCGYGGYGYGSGFGGYGYGSGFG
GYGYGCYRPSYYGGYGFSGFY
NT seq 246 nt NT seq  +upstreamnt  +downstreamnt
atgagctactacggcagctactatggaggcctgggctatggctgtggaggctttggtggc
ctgggctatggctatggctgtggatgtggcagcttccgcagactgggttctggctgtggc
tatggaggctacggatatggctctggctttggaggctatggatatggctctggcttcgga
ggctacggatatggctgctaccgcccatcatactatggaggatatggattctctggattc
tattaa

DBGET integrated database retrieval system