KEGG   Homo sapiens (human): 337971
Entry
337971            CDS       T01001                                 

Gene name
KRTAP19-4, KAP19.4
Definition
(RefSeq) keratin associated protein 19-4
Organism
hsa  Homo sapiens (human)
SSDB
Motif
Pfam: KRTAP Keratin_2_head
Other DBs
NCBI-GeneID: 337971
NCBI-ProteinID: NP_853641
HGNC: 18939
Ensembl: ENSG00000186967
Vega: OTTHUMG00000057767
Pharos: Q3LI73(Tdark)
UniProt: Q3LI73
Position
21q22.11
AA seq 84 aa
MSYYGSYYRGLGYGCGGFGGLGYGYGCGCGSFRRLGYGCGFGGNGYGYCRPSCYGGYGFS
ILLKSYPEDTISEVIRRSFNLTKY
NT seq 255 nt   +upstreamnt  +downstreamnt
atgagctactatggcagctattacagaggcctgggctatggctgtggaggctttggtggc
ctaggctatggctatggctgtggatgtggcagcttccgcagactgggttatggctgtggc
tttggaggcaacggatatggctactgccgcccatcatgctatggaggatatggattctca
attctactgaaatcctaccctgaggacacgatatcagaggtcataagaagatcattcaat
ttaaccaaatattga

DBGET integrated database retrieval system