KEGG   Homo sapiens (human): 337973
Entry
337973            CDS       T01001                                 

Gene name
KRTAP19-6, KAP19.6
Definition
(RefSeq) keratin associated protein 19-6
Organism
hsa  Homo sapiens (human)
SSDB
Motif
Pfam: KRTAP
Other DBs
NCBI-GeneID: 337973
NCBI-ProteinID: NP_853643
HGNC: 18941
Ensembl: ENSG00000186925
Vega: OTTHUMG00000057779
Pharos: Q3LI70(Tdark)
UniProt: Q3LI70 A4FU57
Position
21q22.11
AA seq 58 aa
MRYYGSYYRGLGYGCGGFGGLGYGCGCGGYRYGSGYGGYRYGCCRPSCREGYGFSGFY
NT seq 177 nt   +upstreamnt  +downstreamnt
atgagatactatggcagctactacagaggcctgggatatggctgtggaggctttggtggt
ctgggctatggctgtggctgtggaggctacagatatggctctggctatggaggctataga
tatggctgctgccgcccatcatgccgtgaaggatatggattctctggattctactaa

DBGET integrated database retrieval system