KEGG   Homo sapiens (human): 348645Help
Entry
348645            CDS       T01001                                 

Gene name
C22orf34
Definition
(RefSeq) chromosome 22 open reading frame 34
Organism
hsa  Homo sapiens (human)
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 348645
NCBI-ProteinID: NP_001276851
HGNC: 28010
Ensembl: ENSG00000188511
Pharos: Q6ZV56(Tdark)
UniProt: Q6ZV56
Position
22q13.33
AA seq 151 aa AA seqDB search
MCTVDVEGFDDVGETLSDAVRDGLGTILRGGAEEGSYDNWPHTRKSWGPLSPGHQRELWT
QPDPWTEVLSGHKGDAGACGCCCFCSQFINARCAHPLCLARGLDRRASEEMPILQALCLL
PKVSTRSITVPSPQRSAPRASLCPPHKGKSP
NT seq 456 nt NT seq  +upstreamnt  +downstreamnt
atgtgcacagtggacgtggaaggctttgatgatgttggtgaaactctctctgacgctgtc
agagatggattggggacaatcctgcggggaggtgctgaggagggcagctacgacaactgg
ccccacaccaggaaaagctgggggccgctgagcccaggccaccaacgggagctgtggacc
cagcctgacccctggaccgaggtgctttcagggcacaagggggatgcgggagcctgtggc
tgctgttgcttctgctctcagttcataaacgcacgctgtgcacatcccctgtgcttggca
aggggcctggatagaagggccagtgaggagatgcccatcctccaggcactgtgcctcctc
ccaaaggtcagcacccggagcatcactgtgccctccccacaaaggtcagcaccccgagca
tcactgtgccctccccacaaaggaaaatctccatga

DBGET integrated database retrieval system