KEGG   Homo sapiens (human): 374666Help
Entry
374666            misc_RNA  T01001                                 

Gene name
WASH3P, FAM39DP
Definition
(RefSeq) WASP family homolog 3, pseudogene
Organism
hsa  Homo sapiens (human)
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 374666
HGNC: 24362
Position
15q26.3
NT seq 2590 nt NT seq  +upstreamnt  +downstreamnt
accatttttcagcatacagttcagtgggattaagtagattcacactgttgtgccgccatc
actaccactcatttccagcacccttccatcaccccagcctgaaactctacccattgaaca
cgagctgcccaactccgccttgcttccccattcctggcgaccactgcttctgtctctgtg
aattttgactattctaggcacttcacaaaactggactcatacgatatctgtagttttgcg
tctggcttctctattgaattcttaaaggggggtgggaactaagcagatcacaagggagct
gcccacagaggtaaagacaaggtcaggtaggctgagagacgcaggaaagcgggtcaaggc
gtagggctggagggcaggggcgggccctgggcgtgggctgggggtcctgccccggggcgc
accccgggcgagggctgcccggaggagccgaggttggcggacagcttggccctgagcttg
aggggaaggcagcgatgggacaaaggacggaggtctaggaagagggtctgcagagcagaa
agcacgggtaggggcggcctgacgctcggaagacaacggatgggagccgtgtgcacgtcg
ggagctgggagtgagcgtgagttccgtgcccaggcccgcgactcggtccacgaggacagc
gctccgggtcgacggggtcctggagccgcgctcggggagggcgcagcggagggcgagcgg
cggcgttaggacccggaggcgcgggcggactgtgggcggcggggctaggacccagcggct
ccggcagagcggaagcggcggcgggagcttccgggagggcggctcgcaggcaccatgact
cctgtgaggatgcagcactccctggcaggtcagacctatgccgtgcccctcatccagcca
gacctgcggcgagaggaggccgtccagcagatggcggatgccctgcagtacctgcagaag
gtctctggagacatcttcagcaggtagagcagagccggagccaggtgcaggccattggag
agaaggtctccttggcccaggccaagattgagaagatcaagggcagcaagaaggccatca
aggtgttctccagtgccaagtaccctgctccagagcgcctgcaggaatatggctccatct
tcacgggcgcccaggaccctggcctgcagagacgcccccgccacaggatccagagcaagc
accgccccctggacgagcgggccctgcaggagaagctgactttcctgtgtgcgtgagcac
caagccggagcccgaggacgatgcagaagagggacttgggggtcttcccagcaacatcag
ctctgtcagctccttgctgctcttcaacaccaccgagaacctgtagaagaagtatgtctt
cctggaccccctggctggtgctgtaacaaagacccatgtgatgctgggggcagagacaga
ggagaagctgtttgatgcccccttgtccatcagcaagagagagcagctggaacagcaggt
cccagagaactacttctatgtgccagacctgggccaggtgcctgagattgatgttccatc
ctacctgcctgacctgcccggcattaccaacgacctcatgtacattgctgacctgggccc
cggcattgccccctctgcccctggcaccattccagaactgcccaccttccacactgaggt
agccgagcctctcaaggtagacctacaagatggggtactaacaccacccccaccgccccc
accaccacccccagctcctgaggtgctggccagtgcacccccactcccaccctcaaccgc
ggcccctgtaggccaaggcgccaggcaggacgacagcagcagcagcgcgtctccttcagt
ccagggagctcccagggaagtggttgacccctccggtggccgggccactctgctagagtc
catccgccaagctgggggcatcggcaaggccaagctgcgcagcatgaaggagcgaaagct
ggagaagaagcagcagaaggagcaggagcaagtgagagccacgagccaaggtgggcactt
gatgtcggatctcttcaacaagctggtcatgaggcgcaagggcatctctgggaaaggacc
tggggctggtgaggggcccggaggagcctttgcccgcgtgtcagactccatccctcctct
gccgccaccgcagcagccacaggcagaggaggacgaggacgactgggaatcctagggggc
tccatgacaccttcccccccagacccagacttgggccgttgctctgacatggacacagcc
aggacaagctgctcagacctacttccttgggagggggtgacggaaccagcactgtgtgga
gaccagcttcaaggagcggaaggctggcttgaggccacacagctggggcggggacttctg
tctgcctgtgctccatggggggacggctccacccagcctgcgccactgtgttcttctctt
aagaggcttccagagaaaacggcacaccaatcaataaagaactgagcagaaaccaacagt
gtgcttttaataaaggatctctagctgtgcaggaaaaaaaaaaaaaaaaaaaaaaaaaaa
aaaaaaaaaa

DBGET integrated database retrieval system