KEGG   Homo sapiens (human): 400736Help
Entry
400736            CDS       T01001                                 

Gene name
PRAMEF13
Definition
(RefSeq) PRAME family member 13
Organism
hsa  Homo sapiens (human)
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 400736
NCBI-ProteinID: NP_001278309
HGNC: 13262
Ensembl: ENSG00000279169
Pharos: Q5VWM6(Tdark)
UniProt: Q5VWM6
Position
1p36.21
AA seq 474 aa AA seqDB search
MSIQAPPRLLELAGQSLLRDQALSISAMEELPRVLYLPLFMEAFRRRHFQTLTVMVQAWP
FTCLPLGSLMKTLHLETLKALLEGLHMLLTQKDRPRRRKLQVLDLRDVDENFWARWPGAW
ALSCFPETMSKRQTAEDRPRMGEHQPLKVFIDICLKEIPQDECLRYLFQWVYQRRGLVHL
CCSKLVNYLTPIKHLRKSLKIIYLNSIQELEIHNMSWPRLIRKLRCYLKEMKTLGKLVFS
RCHHSTSDNELEGRLVTKFSSVFLGLEHLQLLKIKLITFFSGHLEQLIRCLQNPLENLEL
TYGYLLEEDVKCLSQYPSLGYLKHLNLSYVLLFRISLEPLGALLEKIAASLETLILEGCQ
IHYSQLSAILPGLSRCSQLTTFYFGRNCMSMGALKDLLRHTSGLSKLSLETYPAPEESLN
SLVRVNWEIFTPLRAELMCTLREVRQPKRIFIGPTPCPSCGSSLSEELELHLCC
NT seq 1425 nt NT seq  +upstreamnt  +downstreamnt
atgagcatccaggccccacccagactcctggagctggcggggcagagcctgctgagagac
caggccttgtccatctctgccatggaggagctgcccagggtgctctatctcccactcttc
atggaggccttccgcaggagacacttccagactctgacggtgatggtgcaggcctggccc
ttcacctgcctccctctgggatcactgatgaagacgcttcatttggagaccttaaaagca
ttgctggaagggcttcatatgctgcttacacagaaggatcgccccaggaggcggaaactt
caagtgctggatttgcgggatgttgacgagaatttctgggccagatggcctggagcctgg
gccctgtcctgcttcccagagaccatgagtaagaggcagacagcagaggaccgtccaagg
atgggagagcaccagcccttaaaggtgttcatagacatctgcctcaaggaaataccccag
gatgaatgcctgagatacctcttccagtgggtttaccaaaggagaggtttagtacacctg
tgctgtagtaagctggtcaattatctaacgccgattaaacatctcagaaagtcattgaaa
ataatatacctgaatagtattcaagagctggaaattcacaacatgtcctggccacgtctg
ataagaaagcttcgttgttacctgaaggagatgaagactcttggcaaactcgttttctcc
aggtgccatcattccacgtcagataatgaactcgaaggacggttagtcaccaaattcagc
tctgtgttcctcgggctggaacacctccagttgcttaaaataaaattgatcaccttcttc
agtgggcacctggaacagctgatcaggtgcctccagaaccccttggagaacttggaatta
acttatggctacctattggaagaggatgtgaagtgtctctcccagtacccaagcctcggt
tacctaaagcatctgaatctcagctacgtgctgctgttccgcatcagtcttgaacccctc
ggagctctgctagagaaaattgctgcctctctcgaaaccctcatcttggagggctgtcag
atccactactcccaactcagtgccatcctgcctggcctgagccgctgctcccagctcacc
accttctactttggcagaaattgtatgtctatgggtgccctgaaggacctgctgcgccac
accagtgggctgagcaagttaagcctggagacgtatcctgcccctgaggagagtttgaat
tccttggttcgtgtcaattgggagatcttcaccccacttcgggctgagctgatgtgtaca
ctgagggaagtcaggcagcccaagaggatcttcattggtcccaccccctgcccttcctgt
ggctcatcactgtctgaggaactggagctccatctttgctgctag

DBGET integrated database retrieval system