KEGG   Homo sapiens (human): 406952Help
Entry
406952            miRNA     T01001                                 

Gene name
MIR17, MIR17-5p, MIR91, MIRN17, MIRN91, hsa-mir-17, miR-17, miR17-3p, miRNA17, miRNA91
Definition
(RefSeq) microRNA 17
  KO
K17002  microRNA 17
Organism
hsa  Homo sapiens (human)
Pathway
hsa05206  MicroRNAs in cancer
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09160 Human Diseases
  09161 Cancer: overview
   05206 MicroRNAs in cancer
    406952 (MIR17)
 09180 Brite Hierarchies
  09183 Protein families: signaling and cellular processes
   04147 Exosome [BR:hsa04147]
    406952 (MIR17)
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    406952 (MIR17)
Exosome [BR:hsa04147]
 Exosomal RNA
  Exosomal RNA of haemopoietic cells
   406952 (MIR17)
  Exosomal RNA of breast milk
   406952 (MIR17)
  Exosomal RNA of saliva
   406952 (MIR17)
  Exosomal RNA of breast cancer cells
   406952 (MIR17)
  Exosomal RNA of colorectal cancer cells
   406952 (MIR17)
  Exosomal RNA of lung cancer cells
   406952 (MIR17)
Non-coding RNAs [BR:hsa03100]
 Micro RNA
  miRNA
   406952 (MIR17)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 406952
OMIM: 609416
HGNC: 31547
Ensembl: ENSG00000284536
miRBase: MI0000071
Position
13q31.3
NT seq 23 nt NT seq  +upstreamnt  +downstreamnt
caaagtgcttacagtgcaggtag

DBGET integrated database retrieval system