KEGG   Homo sapiens (human): 414325Help
Entry
414325            CDS       T01001                                 

Gene name
DEFB103A, BD-3, DEFB-3, DEFB103, DEFB3, HBD3, HBP-3, HBP3
Definition
(RefSeq) defensin beta 103A
  KO
K23126  beta-defensin 103
Organism
hsa  Homo sapiens (human)
Pathway
hsa04621  NOD-like receptor signaling pathway
hsa05150  Staphylococcus aureus infection
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09150 Organismal Systems
  09151 Immune system
   04621 NOD-like receptor signaling pathway
    414325 (DEFB103A)
 09160 Human Diseases
  09171 Infectious diseases: Bacterial
   05150 Staphylococcus aureus infection
    414325 (DEFB103A)
BRITE hierarchy
SSDB OrthologParalogGFIT
Motif
Pfam: Defensin_beta
Motif
Other DBs
NCBI-GeneID: 414325
NCBI-ProteinID: NP_001075020
HGNC: 15967
Ensembl: ENSG00000176797
Vega: OTTHUMG00000143855
UniProt: P81534
Structure
PDB: 

Position
8p23.1
AA seq 67 aa AA seqDB search
MRIHYLLFALLFLFLVPVPGHGGIINTLQKYYCRVRGGRCAVLSCLPKEEQIGKCSTRGR
KCCRRKK
NT seq 204 nt NT seq  +upstreamnt  +downstreamnt
atgaggatccattatcttctgtttgctttgctcttcctgtttttggtgcctgttccaggt
catggaggaatcataaacacattacagaaatattattgcagagtcagaggcggccggtgt
gctgtgctcagctgccttccaaaggaggaacagatcggcaagtgctcgacgcgtggccga
aaatgctgccgaagaaagaaataa

DBGET integrated database retrieval system