KEGG   Homo sapiens (human): 440050Help
Entry
440050            CDS       T01001                                 

Gene name
KRTAP5-7, KRTAP5-3, KRTAP5.7
Definition
(RefSeq) keratin associated protein 5-7
Organism
hsa  Homo sapiens (human)
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 440050
NCBI-ProteinID: NP_001012521
HGNC: 23602
Ensembl: ENSG00000244411
Vega: OTTHUMG00000057570
Pharos: Q6L8G8(Tdark)
UniProt: Q6L8G8
Position
11q13.4
AA seq 165 aa AA seqDB search
MGCCGCSEGCGSGCGGCGSGCGGCGSGCGGCGSSCCVPVCCCKPVCCCVPACSCSSCGSC
GGSKGGCGSCGGSKGGCGSCGGSKGGCGSCGCSQCSCYKPCCCSSGCGSSCCQSSCCKPC
CCQSSCCKPCCCSSGCGSSCCQSSCCNPCCSQSSCCVPVCCQCKI
NT seq 498 nt NT seq  +upstreamnt  +downstreamnt
atgggctgctgtggctgttccgaaggctgtggctccggctgtgggggctgtggctccggc
tgtgggggctgtggctctggctgtgggggatgtggctccagctgctgtgtgcccgtctgc
tgctgcaagcccgtgtgctgctgtgtgccagcctgttcctgctccagctgtggctcctgt
gggggctccaagggaggctgtggctcctgtgggggctccaaggggggctgtggctcttgt
gggggttctaaggggggctgtggttcttgtggctgctcccagtgcagctgctataagccc
tgctgctgctcctcaggctgtgggtcatcctgctgccagtccagctgctgtaagccctgc
tgctgccagtccagctgctgtaagccctgctgctgttcctcaggctgtgggtcatcctgc
tgccagtccagttgctgcaatccctgctgctcccagtctagctgctgtgtccccgtgtgc
tgccagtgtaagatctga

DBGET integrated database retrieval system