KEGG   Homo sapiens (human): 442867Help
Entry
442867            CDS       T01001                                 

Gene name
BPY2B, VCY2B
Definition
(RefSeq) basic charge Y-linked 2B
Organism
hsa  Homo sapiens (human)
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 442867
NCBI-ProteinID: NP_001002760
HGNC: 25449
Ensembl: ENSG00000183795
Vega: OTTHUMG00000045101
UniProt: O14599
Position
Yq11.23
AA seq 106 aa AA seqDB search
MMTLVPRARTRAGQDHYSHPCPRFSQVLLTEGIMTYCLTKNLSDVNILHRLLKNGNVRNT
LLQSKVGLLTYYVKLYPGEVTLLTRPSIQMRLCCITGSVSRPRSQK
NT seq 321 nt NT seq  +upstreamnt  +downstreamnt
atgatgacgcttgtccccagagccaggacacgtgcaggacaggatcattactctcatccc
tgccccagattttcacaggtgctgcttacagagggcatcatgacatattgcttgacaaag
aacctaagtgatgttaatattctgcataggttgctaaaaaatgggaatgtgagaaatacc
ttgcttcagtccaaagtgggcttgctgacatattatgtgaaactgtacccgggtgaagtg
actcttctgactaggcccagcatacaaatgagattatgctgtatcactggctcagtgtcg
aggcccagatcacagaagtaa

DBGET integrated database retrieval system