KEGG   Homo sapiens (human): 4549Help
Entry
4549              rRNA      T01001                                 

Gene name
RNR1, MTRNR1, MT-RNR1
Definition
(RefSeq) s-rRNA
  KO
K01979  small subunit ribosomal RNA
Organism
hsa  Homo sapiens (human)
Pathway
hsa03008  Ribosome biogenesis in eukaryotes
hsa03010  Ribosome
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09120 Genetic Information Processing
  09122 Translation
   03010 Ribosome
    4549 (RNR1)
   03008 Ribosome biogenesis in eukaryotes
    4549 (RNR1)
 09180 Brite Hierarchies
  09182 Protein families: genetic information processing
   03011 Ribosome [BR:hsa03011]
    4549 (RNR1)
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    4549 (RNR1)
Ribosome [BR:hsa03011]
 Ribosomal RNAs
  Eukaryotes
   4549 (RNR1)
Non-coding RNAs [BR:hsa03100]
 Ribosomal RNA
  Small subunit rRNA
   4549 (RNR1)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 4549
OMIM: 561000
HGNC: 7470
Position
MT
NT seq 954 nt NT seq  +upstreamnt  +downstreamnt
aataggtttggtcctagcctttctattagctcttagtaagattacacatgcaagcatccc
cgttccagtgagttcaccctctaaatcaccacgatcaaaaggaacaagcatcaagcacgc
agcaatgcagctcaaaacgcttagcctagccacacccccacgggaaacagcagtgattaa
cctttagcaataaacgaaagtttaactaagctatactaaccccagggttggtcaatttcg
tgccagccaccgcggtcacacgattaacccaagtcaatagaagccggcgtaaagagtgtt
ttagatcaccccctccccaataaagctaaaactcacctgagttgtaaaaaactccagttg
acacaaaatagactacgaaagtggctttaacatatctgaacacacaatagctaagaccca
aactgggattagataccccactatgcttagccctaaacctcaacagttaaatcaacaaaa
ctgctcgccagaacactacgagccacagcttaaaactcaaaggacctggcggtgcttcat
atccctctagaggagcctgttctgtaatcgataaaccccgatcaacctcaccacctcttg
ctcagcctatataccgccatcttcagcaaaccctgatgaaggctacaaagtaagcgcaag
tacccacgtaaagacgttaggtcaaggtgtagcccatgaggtggcaagaaatgggctaca
ttttctaccccagaaaactacgatagcccttatgaaacttaagggtcgaaggtggattta
gcagtaaactaagagtagagtgcttagttgaacagggccctgaagcgcgtacacaccgcc
cgtcaccctcctcaagtatacttcaaaggacatttaactaaaacccctacgcatttatat
agaggagacaagtcgtaacatggtaagtgtactggaaagtgcacttggacgaac

DBGET integrated database retrieval system