KEGG   Homo sapiens (human): 4563Help
Entry
4563              tRNA      T01001                                 

Gene name
TRNG, MTTG, MT-TG
Definition
(RefSeq) tRNA-Gly
  KO
K14225  tRNA Gly
Organism
hsa  Homo sapiens (human)
Pathway
hsa00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    4563 (TRNG)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    4563 (TRNG)
Non-coding RNAs [BR:hsa03100]
 Transfer RNA
  tRNA
   4563 (TRNG)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 4563
OMIM: 590035
HGNC: 7486
Position
MT
NT seq 68 nt NT seq  +upstreamnt  +downstreamnt
actcttttagtataaatagtaccgttaacttccaattaactagttttgacaacattcaaa
aaagagta

DBGET integrated database retrieval system