KEGG   Homo sapiens (human): 4573Help
Entry
4573              tRNA      T01001                                 

Gene name
TRNR, MTTR, MT-TR
Definition
(RefSeq) tRNA-Arg
  KO
K14219  tRNA Arg
Organism
hsa  Homo sapiens (human)
Pathway
hsa00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    4573 (TRNR)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    4573 (TRNR)
Non-coding RNAs [BR:hsa03100]
 Transfer RNA
  tRNA
   4573 (TRNR)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 4573
OMIM: 590005
HGNC: 7496
Position
MT
NT seq 65 nt NT seq  +upstreamnt  +downstreamnt
tggtatatagtttaaacaaaacgaatgatttcgactcattaaattatgataatcatattt
accaa

DBGET integrated database retrieval system