KEGG   Homo sapiens (human): 4575Help
Entry
4575              tRNA      T01001                                 

Gene name
TRNS2, MTTS2, MT-TS2
Definition
(RefSeq) tRNA-Ser
  KO
K14233  tRNA Ser
Organism
hsa  Homo sapiens (human)
Pathway
hsa00970  Aminoacyl-tRNA biosynthesis
Disease
H01347  MELAS Syndrome
H01356  Myoclonic Epilepsy and Ragged-Red Fiber Disease
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    4575 (TRNS2)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    4575 (TRNS2)
Non-coding RNAs [BR:hsa03100]
 Transfer RNA
  tRNA
   4575 (TRNS2)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 4575
OMIM: 590085
HGNC: 7498
Position
MT
NT seq 59 nt NT seq  +upstreamnt  +downstreamnt
gagaaagctcacaagaactgctaactcatgcccccatgtctaacaacatggctttctca

DBGET integrated database retrieval system