KEGG   Homo sapiens (human): 4576Help
Entry
4576              tRNA      T01001                                 

Gene name
TRNT, MTTT, MT-TT, LIMM
Definition
(RefSeq) tRNA-Thr
  KO
K14234  tRNA Thr
Organism
hsa  Homo sapiens (human)
Pathway
hsa00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    4576 (TRNT)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    4576 (TRNT)
Non-coding RNAs [BR:hsa03100]
 Transfer RNA
  tRNA
   4576 (TRNT)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 4576
OMIM: 590090
HGNC: 7499
Position
MT
NT seq 66 nt NT seq  +upstreamnt  +downstreamnt
gtccttgtagtataaactaatacaccagtcttgtaaaccggagatgaaaacctttttcca
aggaca

DBGET integrated database retrieval system