KEGG   Homo sapiens (human): 51233
Entry
51233             CDS       T01001                                 

Gene name
DRICH1, C22orf43, KB-208E9.1
Definition
(RefSeq) aspartate rich 1
Organism
hsa  Homo sapiens (human)
SSDB
Other DBs
NCBI-GeneID: 51233
NCBI-ProteinID: NP_057533
HGNC: 28031
Ensembl: ENSG00000189269
Vega: OTTHUMG00000186352
Pharos: Q6PGQ1(Tdark)
UniProt: Q6PGQ1
Position
22q11.23
AA seq 229 aa
MGNILTCCINSHCGWPRGKDAPCYESDTDIYETVAAATSESTTVEPGKLDVGATEGQDLQ
HISNQKMPTGPPEDRLSLKFLPSSEEDNDDAKILPSPVQGSSEDNLSLVCLPRSEDDDCD
DDDDDDAQILPSRVQGGCYRFDSSSCSSEDNLSLVCLPRSEDDDCDDDDDDAQILPSPVQ
ACSEDSLFLRCSLRHKDEEEEDDDDIHITARIESDLTLESLSDEEIHPG
NT seq 690 nt   +upstreamnt  +downstreamnt
atggggaatatactgacctgttgtatcaactcccactgtggctggcccagggggaaggac
gcaccctgttatgaatctgatactgatatttatgagactgtggctgctgcaacatcagaa
tccactactgtagagcctggcaagctggatgtgggagccacggagggccaagacctgcag
cacatcagcaaccaaaagatgcccacaggtccccctgaggaccgcctgagtttaaaattt
ctgccatcaagtgaggaagacaatgatgatgccaagattttaccatcacctgtccagggt
tcttctgaggacaacctgagtttagtatgcctaccacgaagtgaagatgatgactgtgat
gatgatgatgatgatgatgcccagattttaccgtcacgtgtccagggtggctgttaccgg
tttgatagcagttcttgttcttctgaggacaacctgagtttagtatgcctaccacgaagt
gaagatgatgactgtgatgatgatgatgatgatgcccagattttaccgtcacctgtccag
gcttgttctgaagatagcctgtttttaagatgctcactgagacacaaagatgaagaagaa
gaagatgatgatgacatccacataacagctcggatagaaagtgacttgacgctggagagt
ctaagtgatgaagagattcatccagggtga

DBGET integrated database retrieval system