KEGG   Homo sapiens (human): 51646
Entry
51646             CDS       T01001                                 

Gene name
YPEL5, CGI-127
Definition
(RefSeq) yippee like 5
  KO
K23339  protein yippee-like 5
Organism
hsa  Homo sapiens (human)
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09180 Brite Hierarchies
  09182 Protein families: genetic information processing
   04121 Ubiquitin system [BR:hsa04121]
    51646 (YPEL5)
Ubiquitin system [BR:hsa04121]
 Ubiquitin ligases (E3)
  Multi subunit Ring-finger type E3
   CTLH complex
    51646 (YPEL5)
SSDB
Motif
Pfam: Yippee-Mis18 SelR RIG-I_C-RD HNH_5 Endonuclease_7 HECT_2
Other DBs
NCBI-GeneID: 51646
NCBI-ProteinID: NP_001120871
OMIM: 609726
HGNC: 18329
Ensembl: ENSG00000119801
Vega: OTTHUMG00000097839
Pharos: P62699(Tdark)
UniProt: P62699
Position
2p23.1
AA seq 121 aa
MGRIFLDHIGGTRLFSCANCDTILTNRSELISTRFTGATGRAFLFNKVVNLQYSEVQDRV
MLTGRHMVRDVSCKNCNSKLGWIYEFATEDSQRYKEGRVILERALVRESEGFEEHVPSDN
S
NT seq 366 nt   +upstreamnt  +downstreamnt
atgggcagaattttccttgatcatatcggtggtacccgtctgttttcttgtgcaaactgt
gatacgatcctgaccaaccgctcagaactcatctccactcgtttcacaggcgccactggc
agagcatttctttttaacaaggtagttaacctgcagtacagtgaagttcaagatcgggtc
atgctcactggccgccacatggttcgagatgtgagctgcaaaaactgcaatagcaaactg
ggatggatctatgagtttgccactgaagacagccagcgatataaggaaggccgcgtgatc
ctggaacgtgctctagttcgagagagtgagggctttgaggagcatgtaccatctgataac
tcttga

DBGET integrated database retrieval system