KEGG   Homo sapiens (human): 55894Help
Entry
55894             CDS       T01001                                 

Gene name
DEFB103B, BD-3, DEFB-3, DEFB103, DEFB3, HBD-3, HBD3, HBP-3, HBP3
Definition
(RefSeq) defensin beta 103B
  KO
K23126  beta-defensin 103
Organism
hsa  Homo sapiens (human)
Pathway
hsa04621  NOD-like receptor signaling pathway
hsa05150  Staphylococcus aureus infection
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09150 Organismal Systems
  09151 Immune system
   04621 NOD-like receptor signaling pathway
    55894 (DEFB103B)
 09160 Human Diseases
  09171 Infectious diseases: Bacterial
   05150 Staphylococcus aureus infection
    55894 (DEFB103B)
BRITE hierarchy
SSDB OrthologParalogGFIT
Motif
Pfam: Defensin_beta
Motif
Other DBs
NCBI-GeneID: 55894
NCBI-ProteinID: NP_061131
OMIM: 606611
HGNC: 31702
Ensembl: ENSG00000177243
Vega: OTTHUMG00000129313
Pharos: P81534(Tbio)
UniProt: P81534
Structure
PDB: 

Position
8p23.1
AA seq 67 aa AA seqDB search
MRIHYLLFALLFLFLVPVPGHGGIINTLQKYYCRVRGGRCAVLSCLPKEEQIGKCSTRGR
KCCRRKK
NT seq 204 nt NT seq  +upstreamnt  +downstreamnt
atgaggatccattatcttctgtttgctttgctcttcctgtttttggtgcctgttccaggt
catggaggaatcataaacacattacagaaatattattgcagagtcagaggcggccggtgt
gctgtgctcagctgccttccaaaggaggaacagatcggcaagtgctcgacgcgtggccga
aaatgctgccgaagaaagaaataa

DBGET integrated database retrieval system