KEGG   Homo sapiens (human): 57830Help
Entry
57830             CDS       T01001                                 

Gene name
KRTAP5-8, KRTAP5-2, KRTAP5.8, UHSKerB
Definition
(RefSeq) keratin associated protein 5-8
Organism
hsa  Homo sapiens (human)
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 57830
NCBI-ProteinID: NP_066384
HGNC: 23603
Ensembl: ENSG00000241233
Vega: OTTHUMG00000057571
Pharos: O75690(Tdark)
UniProt: O75690
Position
11q13.4
AA seq 187 aa AA seqDB search
MGCCGCSGGCGSGCGGCGSGCGGCGSSCCVPICCCKPVCCCVPACSCSSCGSCGGSKGGR
GSCGGSKGDCGSCGGSKGGCGSCGCSQCSCYKPCCCSSGCGSSCCQSSCCKPCCSQSSCC
KPCSCSSGCGSSCCQSSCCKPCCSQSSCCKPCCCSSGCGSSCCQSSCCKPCCSQSSCCVP
ICCQCKI
NT seq 564 nt NT seq  +upstreamnt  +downstreamnt
atgggctgctgtggctgctctggaggctgtggctccggctgtgggggctgcggctctggc
tgtgggggatgtggctctagctgctgtgtgcccatctgctgctgcaagcccgtgtgctgc
tgtgtgccagcctgttcctgctccagctgtggctcctgtgggggctccaaggggggccgt
ggctcctgtgggggctccaagggggactgtggctcctgtgggggctccaagggaggctgt
ggttcttgtggctgctcccagtgcagctgctataagccctgctgttgctcctcaggctgt
gggtcatcctgctgccagtccagctgctgcaaaccctgctgttcccagtccagctgttgt
aagccctgcagctgctcttcaggctgtgggtcatcctgctgccagtccagctgctgcaag
ccctgctgttcccagtccagctgctgtaagccctgctgctgctcttcaggctgtgggtca
tcctgctgccagtccagctgctgcaagccctgctgttcccagtccagctgctgtgtccca
atttgctgccagtgcaagatctga

DBGET integrated database retrieval system