KEGG   Homo sapiens (human): 6023
Entry
6023              ncRNA     T01001                                 

Gene name
RMRP, CHH, NME1, RMRPR, RRP2
Definition
(RefSeq) RNA component of mitochondrial RNA processing endoribonuclease
  KO
K14576  small nucleolar RNA MRP
Organism
hsa  Homo sapiens (human)
Pathway
hsa03008  Ribosome biogenesis in eukaryotes
Disease
H00107  Other well-defined immunodeficiency syndromes
H00479  Metaphyseal dysplasias
H00518  Metaphyseal dysplasia without hypotrichosis
H01966  Cartilage-hair hypoplasia
H01967  Anauxetic dysplasia
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09120 Genetic Information Processing
  09122 Translation
   03008 Ribosome biogenesis in eukaryotes
    6023 (RMRP)
 09180 Brite Hierarchies
  09182 Protein families: genetic information processing
   03009 Ribosome biogenesis [BR:hsa03009]
    6023 (RMRP)
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    6023 (RMRP)
Ribosome biogenesis [BR:hsa03009]
 Related small nucleolar RNAs
  Other snoRNA
   6023 (RMRP)
Non-coding RNAs [BR:hsa03100]
 Small non-coding RNA
  Small nucleolar RNA
   6023 (RMRP)
SSDB
Other DBs
NCBI-GeneID: 6023
OMIM: 157660
HGNC: 10031
Ensembl: ENSG00000269900
Position
9p13.3
NT seq 277 nt   +upstreamnt  +downstreamnt
ggttcgtgctgaaggcctgtatcctaggctacacactgaggactctgttcctcccctttc
cgcctaggggaaagtccccggacctcgggcagagagtgccacgtgcatacgcacgtagac
attccccgcttcccactccaaagtccgccaagaagcgtatcccgctgagcggcgtggcgc
gggggcgtcatccgtcagctccctctagttacgcaggcagtgcgtgtccgcgcaccaacc
acacggggctcattctcagcgcggctgtaaaaaaaaa

DBGET integrated database retrieval system