KEGG   Homo sapiens (human): 63967
Entry
63967             CDS       T01001                                 

Gene name
CLSPN
Definition
(RefSeq) claspin
Organism
hsa  Homo sapiens (human)
SSDB
Other DBs
NCBI-GeneID: 63967
NCBI-ProteinID: NP_071394
OMIM: 605434
HGNC: 19715
Ensembl: ENSG00000092853
Vega: OTTHUMG00000004168
Pharos: Q9HAW4(Tbio)
UniProt: Q9HAW4
Position
1p34.3
AA seq 1339 aa
MTGEVGSEVHLEINDPNVISQEEADSPSDSGQGSYETIGPLSEGDSDEEIFVSKKLKNRK
VLQDSDSETEDTNASPEKTTYDSAEEENKENLYAGKNTKIKRIYKTVADSDESYMEKSLY
QENLEAQVKPCLELSLQSGNSTDFTTDRKSSKKHIHDKEGTAGKAKVKSKRRLEKEERKM
EKIRQLKKKETKNQEDDVEQPFNDSGCLLVDKDLFETGLEDENNSPLEDEESLESIRAAV
KNKVKKHKKKEPSLESGVHSFEEGSELSKGTTRKERKAARLSKEALKQLHSETQRLIRES
ALNLPYHMPENKTIHDFFKRKPRPTCHGNAMALLKSSKYQSSHHKEIIDTANTTEMNSDH
HSKGSEQTTGAENEVETNALPVVSKETQIITGSDESCRKDLVKNEELEIQEKQKQSDIRP
SPGDSSVLQQESNFLGNNHSEECQVGGLVAFEPHALEGEGPQNPEETDEKVEEPEQQNKS
SAVGPPEKVRRFTLDRLKQLGVDVSIKPRLGADEDSFVILEPETNRELEALKQRFWKHAN
PAAKPRAGQTVNVNVIVKDMGTDGKEELKADVVPVTLAPKKLDGASHTKPGEKLQVLKAK
LQEAMKLRRFEERQKRQALFKLDNEDGFEEEEEEEEEMTDESEEDGEEKVEKEEKEEELE
EEEEKEEEEEEEGNQETAEFLLSSEEIETKDEKEMDKENNDGSSEIGKAVGFLSVPKSLS
SDSTLLLFKDSSSKMGYFPTEEKSETDENSGKQPSKLDEDDSCSLLTKESSHNSSFELIG
STIPSYQPCNRQTGRGTSFFPTAGGFRSPSPGLFRASLVSSASKSSGKLSEPSLPIEDSQ
DLYNASPEPKTLFLGAGDFQFCLEDDTQSQLLDADGFLNVRNHRNQYQALKPRLPLASMD
ENAMDANMDELLDLCTGKFTSQAEKHLPRKSDKKENMEELLNLCSGKFTSQDASTPASSE
LNKQEKESSMGDPMEEALALCSGSFPTDKEEEDEEEEFGDFRLVSNDNEFDSDEDEHSDS
GNDLALEDHEDDDEEELLKRSEKLKRQMRLRKYLEDEAEVSGSDVGSEDEYDGEEIDEYE
EDVIDEVLPSDEELQSQIKKIHMKTMLDDDKRQLRLYQERYLADGDLHSDGPGRMRKFRW
KNIDDASQMDLFHRDSDDDQTEEQLDESEARWRKERIEREQWLRDMAQQGKITAEEEEEI
GEDSQFMILAKKVTAKALQKNASRPMVIQESKSLLRNPFEAIRPGSAQQVKTGSLLNQPK
AVLQKLAALSDHNPSAPRNSRNFVFHTLSPVKAEAAKESSKSQVKKRGPSFMTSPSPKHL
KTDDSTSGLTRSIFKYLES
NT seq 4020 nt   +upstreamnt  +downstreamnt
atgacaggcgaggtgggttctgaggttcacctagaaatcaatgacccaaacgtcatttca
caagaggaagcagatagtccttcagatagtggacagggcagctatgaaacaattggaccc
ttgagtgaaggagattcagatgaagagatatttgtaagtaagaagttgaaaaacaggaag
gttctacaagacagtgattccgaaacagaggacacaaatgcctctccagagaaaactacc
tatgacagtgccgaggaggaaaataaagagaatttatatgctgggaaaaatacaaaaatc
aaaaggatttacaaaactgtggcagacagtgatgaaagttacatggaaaagtctttgtat
caggaaaatcttgaagcgcaagtgaaaccttgcttagagctgagtcttcagtctggaaac
tctacagactttaccactgacagaaagagttccaaaaagcacatacatgataaagaagga
actgcaggaaaagcaaaagtaaaatcaaaaagaagacttgagaaagaggagagaaaaatg
gaaaaaattagacagctaaaaaagaaggaaacaaaaaaccaggaagatgatgtagaacag
ccatttaatgacagtggctgtcttcttgtggataaagacctttttgaaactgggttggag
gatgaaaataactctccattggaagatgaagagtcattagaatcaataagagcagctgta
aaaaacaaagtaaaaaagcacaagaaaaaagaaccatctttggagagtggggtccattca
tttgaggaaggaagtgagttatcaaaaggaaccacgaggaaggaaagaaaggcagccaga
ttaagtaaagaagcattaaaacaactgcatagtgagactcagcgccttattcgagagtct
gcactgaaccttccatatcatatgcctgagaataaaaccattcatgatttcttcaaacgt
aaaccccggcccacttgccacggaaatgccatggcactattgaagtcatctaaatatcag
tcaagccatcacaaagaaatcatagacactgcaaatactactgaaatgaacagtgatcac
catagtaaaggttctgagcagacaacaggtgcagaaaatgaagtggaaactaatgcactc
cctgtagtttcaaaggaaacccagatcattactggatcagatgagtcttgcaggaaggat
ttggtaaaaaatgaagagctagaaattcaggagaaacagaagcagagtgacattagacct
tcacctggggacagctcagtgttgcaacaggaatccaacttcctcgggaacaatcacagt
gaggaatgtcaggttggagggcttgtagcatttgaacctcatgccctggagggtgaaggc
ccccaaaatccagaagaaacagatgagaaagtggaagagcctgagcagcaaaataaatca
tcagcagttgggccacctgaaaaagtgagacggtttactctggatagacttaagcaactg
ggagtagatgtttccattaaaccacggctaggtgctgatgaagattcctttgtgatactt
gaacctgaaaccaacagagaactggaagccttgaagcagcgtttctggaagcatgctaat
ccagcagccaaacccagggctggtcagacagtgaatgtgaacgtcatagtgaaagacatg
ggcactgatggaaaggaagagctaaaagcagatgtggtacctgtgactttagcacctaag
aagttggatggagcaagccacacaaaaccaggtgaaaagcttcaggtgttaaaagctaaa
ctgcaagaagcaatgaaactccgaaggtttgaggagcgccagaagcgccaagcactgttt
aaattagataatgaagatgggtttgaggaagaggaggaggaagaggaagaaatgacagat
gagtctgaggaagatggagaagagaaggtagagaaagaagagaaagaggaagaactagag
gaagaggaggagaaagaagaggaggaggaagaagaaggaaatcaggagactgcagaattc
cttcttagtagtgaagaaatagaaacaaaagatgaaaaagaaatggataaagaaaataat
gatggcagtagtgaaattggcaaggcagttggcttcctctctgttcccaagtctctctca
tcagattctactttacttctgtttaaggacagctcttccaagatgggttactttcctact
gaagaaaaatcagaaacagatgaaaactcaggcaagcagcctagcaaactggatgaggat
gattcatgttcattgctaacaaaggagagcagccacaatagcagctttgagctgattggc
tccacgattccatcctatcagccttgcaacagacaaacaggccgtgggaccagttttttc
cctacagcaggaggattcagatctccttcccctgggctatttcgagccagtttggtcagc
tcagcttctaagagttcagggaaactgtctgagccttcacttcccatagaggattcccag
gatctgtataacgcctccccagagcctaagacacttttcctaggagcaggagacttccag
ttctgtttagaagatgacactcagagccaactgttggatgcagatgggttcttaaatgtt
agaaaccacaggaatcagtaccaagctttgaagcctcgattgccattggccagtatggat
gagaatgccatggatgccaacatggatgagctgttggatttgtgtactggaaagttcaca
tctcaggctgaaaaacatctacccaggaagagtgacaagaaagagaacatggaggaactt
ctgaacctttgttcaggaaaattcacttctcaggatgcctccactccagcctcatcagag
ttaaataaacaggagaaggagagcagcatgggtgatccaatggaagaagcacttgctctt
tgctcaggctcttttcccacagacaaggaagaggaagacgaggaggaggaatttggagac
tttcggcttgtttcaaatgataatgagtttgatagtgatgaggatgaacacagtgactct
ggtaatgatctggcactggaagaccatgaagatgatgatgaagaagaactcctgaagcga
tctgagaagttgaaaaggcaaatgaggttgaggaaatacctggaggatgaggcagaggtg
tcaggaagtgatgtgggaagcgaagatgagtatgatggggaagaaattgatgaatatgaa
gaggacgtaattgatgaagtacttccttctgatgaggaactgcagagtcaaatcaagaaa
atacacatgaaaactatgttggatgatgataagcgacagctacgtttataccaagagagg
taccttgctgatggggatctgcacagcgatggtcctgggcgaatgaggaagtttcgatgg
aaaaacatagatgatgcttcccagatggacttgttccacagagactctgatgatgatcag
actgaagaacagcttgatgagtcagaagccaggtggaggaaggagcgaattgaacgagag
cagtggcttcgggacatggcacagcaggggaaaattacagctgaagaagaagaagaaatt
ggggaggacagtcagtttatgatactggccaagaaagttacagccaaagcactgcagaag
aatgccagtcgccctatggttattcaggaatcaaagtctttgctcagaaatccttttgaa
gccatcagaccaggaagtgctcaacaggtgaagacaggctcactgctaaaccagcccaaa
gctgtgcttcagaaactggctgctctctctgaccataaccccagtgctcctcgaaattca
agaaactttgtctttcatacactttctcctgtcaaggctgaggcggcaaaggaatcgtct
aagtctcaggtaaagaaaaggggtccatctttcatgacttctccttcacctaagcacctc
aaaacagatgatagcacttcaggattgacgcgaagcatcttcaaatatttggagagctaa

DBGET integrated database retrieval system