KEGG   Homo sapiens (human): 64111Help
Entry
64111             CDS       T01001                                 

Gene name
NPVF, C7orf9, RFRP
Definition
(RefSeq) neuropeptide VF precursor
Organism
hsa  Homo sapiens (human)
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 64111
NCBI-ProteinID: NP_071433
OMIM: 616984
HGNC: 13782
Ensembl: ENSG00000105954
Vega: OTTHUMG00000128509
Pharos: Q9HCQ7(Tdark)
CPD: C16045 C16109 C16110
UniProt: Q9HCQ7
Position
7p15.3
AA seq 196 aa AA seqDB search
MEIISSKLFILLTLATSSLLTSNIFCADELVMSNLHSKENYDKYSEPRGYPKGERSLNFE
ELKDWGPKNVIKMSTPAVNKMPHSFANLPLRFGRNVQEERSAGATANLPLRSGRNMEVSL
VRRVPNLPQRFGRTTTAKSVCRMLSDLCQGSMHSPCANDLFYSMTCQHQEIQNPDQKQSR
RLLFKKIDDAELKQEK
NT seq 591 nt NT seq  +upstreamnt  +downstreamnt
atggaaattatttcatcaaaactattcattttattgactttagccacttcaagcttgtta
acatcaaacattttttgtgcagatgaattagtgatgtccaatcttcacagcaaagaaaat
tatgacaaatattctgagcctagaggatacccaaaaggggaaagaagcctcaattttgag
gaattaaaagattggggaccaaaaaatgttattaagatgagtacacctgcagtcaataaa
atgccacactccttcgccaacttgccattgagatttgggaggaacgttcaagaagaaaga
agtgctggagcaacagccaacctgcctctgagatctggaagaaatatggaggtgagcctc
gtgagacgtgttcctaacctgccccaaaggtttgggagaacaacaacagccaaaagtgtc
tgcaggatgctgagtgatttgtgtcaaggatccatgcattcaccatgtgccaatgactta
ttttactccatgacctgccagcaccaagaaatccagaatcccgatcaaaaacagtcaagg
agactgctattcaagaaaatagatgatgcagaattgaaacaagaaaaataa

DBGET integrated database retrieval system