KEGG   Homo sapiens (human): 641654Help
Entry
641654            CDS       T01001                                 

Gene name
HEPN1
Definition
(RefSeq) hepatocellular carcinoma, down-regulated 1
Organism
hsa  Homo sapiens (human)
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 641654
NCBI-ProteinID: NP_001032647
OMIM: 611641
HGNC: 34400
Ensembl: ENSG00000221932
Vega: OTTHUMG00000165939
Pharos: Q6WQI6(Tdark)
UniProt: Q6WQI6
Position
11q24.2
AA seq 88 aa AA seqDB search
MGNWGLGIAPWVDGESELEFRRLGMQGPLEALRRREWNTQRASFSFSFLIALSPHTVDYC
HSYELFNRRWHGHVLATQRPSLFILMLV
NT seq 267 nt NT seq  +upstreamnt  +downstreamnt
atgggtaactggggccttggaattgctccatgggttgatggcgaatcagagctggagttt
aggagactagggatgcaaggacccttggaggcattaaggaggagggaatggaatacacag
agggcctccttctctttcagctttttaattgccctctctcctcacacagtagattactgc
cactcctatgaactgttcaataggcggtggcatgggcatgtcctggctacacagcggccc
agcctctttattttgatgttagtgtga

DBGET integrated database retrieval system