KEGG   Homo sapiens (human): 644844Help
Entry
644844            CDS       T01001                                 

Gene name
PHGR1
Definition
(RefSeq) proline, histidine and glycine rich 1
Organism
hsa  Homo sapiens (human)
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 644844
NCBI-ProteinID: NP_001139115
HGNC: 37226
Ensembl: ENSG00000233041
Vega: OTTHUMG00000172416
Pharos: C9JFL3(Tdark)
UniProt: C9JFL3 A0A1L2EC20
Position
15q15.1
AA seq 82 aa AA seqDB search
MDPGPKGHCHCGGHGHPPGHCGPPPGHGPGPCGPPPHHGPGPCGPPPGHGPGPCGPPPHH
GPGPCGPPPGHGPGHPPPGPHH
NT seq 249 nt NT seq  +upstreamnt  +downstreamnt
atggacccaggtccgaaggggcactgccactgtggggggcatggccatcctccaggtcac
tgcgggccaccccctggccatggcccagggccctgcgggccacccccccaccatggtcca
gggccctgcgggccaccccctggccatggcccagggccctgcgggccacccccccaccat
ggtccagggccctgcgggcctccccctggccatggcccaggtcacccaccccctggtcca
catcactga

DBGET integrated database retrieval system