KEGG   Homo sapiens (human): 645425Help
Entry
645425            CDS       T01001                                 

Gene name
PRAMEF20, PRAMEF21
Definition
(RefSeq) PRAME family member 20
Organism
hsa  Homo sapiens (human)
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 645425
NCBI-ProteinID: NP_001093322
HGNC: 25224
Ensembl: ENSG00000204478
Vega: OTTHUMG00000007911
Pharos: Q5VT98(Tdark)
UniProt: Q5VT98
Position
1p36.21
AA seq 475 aa AA seqDB search
MSIRTPPRLLELAGRSLLRDEALAISTLEELPTELFPPLFMEAFSRRHCEALKLMVQAWP
FLRLPLGSLMKRPCPETFQAVLDGLDALLTHRVRLRRWKLQVLDLQDVSENFWMVWSEAM
ARRCLPNAMMNRKPLQDCPRMRGQQPLTVFIDLCLKNRTLDEYFTCLFLWVKQREGLVHL
CCKKLKMLGMLFHNIRNILKTVNLDCIQEVEVNCNWTLPVLAEFTPYLGQMRNLRKLVLS
DIDSRYISPEQKKEFVTQFTTQFLKLRCLQKLYMNSVSFLEGHLDQMLSCLKTSLNILAI
TNCVLLESDLKHLSKYPSIGQLKTLDLSGTRLANFSLVPLQVLLEKVAATLEYLDLDDCG
IVDSQVNAILPALSRCFELTTFSFRGNPISTATLENLLCHTIRLNNLCLELYPAPRESYD
VRGIVCRSRFAQLGAELMGRVRALREPERILFCTDYCPQCGNRSLYDLEVDRCCC
NT seq 1428 nt NT seq  +upstreamnt  +downstreamnt
atgagcatccggactccacccagactcctggagctggcggggcggagcctgctgagggac
gaggccttggccatctccaccctggaggagctgcccacggaactttttcccccattgttc
atggaggccttcagcaggagacactgtgaggccctgaagctgatggtgcaggcctggcct
ttcctccgccttcctctggggtctctgatgaaaaggccttgcccagagaccttccaagct
gtgctcgatgggcttgatgcactgcttacccacagggttcgtctcaggaggtggaaactt
caagtgctggatttacaggatgtcagtgagaacttctggatggtttggtctgaagccatg
gcccgtaggtgcttaccaaatgccatgatgaacagaaaaccactgcaggactgtccaagg
atgagaggacagcagcccttgactgtgttcatagacctttgcctcaagaacaggactctg
gatgaatacttcacctgcctctttctatgggtcaagcagagggaaggtttagtacacctg
tgctgtaagaagctgaaaatgttgggaatgctcttccacaatatcagaaacatcctgaaa
acagtcaacctagactgtatccaggaggtggaagtgaattgcaattggacactgcccgtc
ctggcagagtttaccccatacctcggccagatgaggaatcttcggaagctcgttctctct
gacatagattctcgctacatttccccagagcagaagaaggagtttgttacccagttcacc
actcagttcctcaagctgcgctgcctccaaaagctttatatgaactctgtttctttcctc
gaaggccacctggaccagatgctcagctgtctaaagacctcgttaaacatcctcgcaata
actaactgtgtgcttttggaatcagacttgaagcatctgtccaagtacccgagcattggt
caactaaagaccctggacctgagtggcaccagactggccaatttcagccttgtgccgctc
caagttctcctagaaaaagttgcagccacccttgagtacctggacttagatgactgtggc
atcgtagactcccaagtcaacgccatcctgcctgccctgagccgctgctttgagctcacc
accttcagcttccgtggaaatcccatctccacggccaccctggagaacctgctgtgccac
acaatcagactcaacaacttatgcctggagctgtatcctgccccgcgggagagttatgat
gttcgtggtatcgtctgccggagcagatttgcccaacttggggctgagctgatggggaga
gtgagggccttaagggagcccgagaggatcttgttctgtaccgactactgccctcagtgt
ggcaacaggtcactttacgacctggaggtagatcggtgttgctgttga

DBGET integrated database retrieval system