KEGG   Homo sapiens (human): 647310Help
Entry
647310            CDS       T01001                                 

Gene name
TEX22
Definition
(RefSeq) testis expressed 22
Organism
hsa  Homo sapiens (human)
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 647310
NCBI-ProteinID: NP_001182011
HGNC: 40026
Ensembl: ENSG00000226174
Vega: OTTHUMG00000156137
Pharos: C9J3V5(Tdark)
UniProt: C9J3V5
Position
14q32.33
AA seq 150 aa AA seqDB search
MDSRKLSPRGKKLESHLSQEHRRPPLGLIAAWGQPSIQSSVQQGLQTQDWVCEPPERRRP
GRRWSVSIDERRRLATLGGRERPGAAGTQLHCRDVVQMVAQLVSEDVDKDVLLPHPLRST
ESTNAFQAFLARSAPFWHNATFEASRSPPS
NT seq 453 nt NT seq  +upstreamnt  +downstreamnt
atggacagcaggaaactgtccccccgggggaagaagctggagtcgcacctctcccaagag
cacaggcggcccccactgggcctgatagcagcctggggccagcccagtatccagagcagc
gttcagcagggactgcagactcaggactgggtgtgcgagccgccggaacgcaggcgcccg
ggccgccgctggagcgtcagcatcgacgagcgccggcggctggccacgctgggcggccgg
gagaggccgggcgccgccgggacccagctgcactgcagggacgtcgtgcagatggtagcc
cagctggtgtcggaggacgtggacaaggacgtgctccttccccacccgctgaggtccacc
gagtccaccaacgccttccaggccttcctggcgcgcagtgcgcctttctggcataatgcg
actttcgaggcctcgaggtcacccccttcctaa

DBGET integrated database retrieval system