KEGG   Homo sapiens (human): 693142Help
Entry
693142            miRNA     T01001                                 

Gene name
MIR557, MIRN557, hsa-mir-557
Definition
(RefSeq) microRNA 557
  KO
K17156  microRNA 557
Organism
hsa  Homo sapiens (human)
Brite
KEGG Orthology (KO) [BR:hsa00001]
 09180 Brite Hierarchies
  09183 Protein families: signaling and cellular processes
   04147 Exosome [BR:hsa04147]
    693142 (MIR557)
  09184 RNA family
   03100 Non-coding RNAs [BR:hsa03100]
    693142 (MIR557)
Exosome [BR:hsa04147]
 Exosomal RNA
  Exosomal RNA of ovarian cancer cells
   693142 (MIR557)
Non-coding RNAs [BR:hsa03100]
 Micro RNA
  miRNA
   693142 (MIR557)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 693142
HGNC: 32813
Ensembl: ENSG00000207974
miRBase: MI0003563
Position
1q24.2
NT seq 23 nt NT seq  +upstreamnt  +downstreamnt
gtttgcacgggtgggccttgtct

DBGET integrated database retrieval system