KEGG   Homo sapiens (human): 7425Help
Entry
7425              CDS       T01001                                 

Gene name
VGF, SCG7, SgVII
Definition
(RefSeq) VGF nerve growth factor inducible
Organism
hsa  Homo sapiens (human)
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 7425
NCBI-ProteinID: NP_003369
OMIM: 602186
HGNC: 12684
Ensembl: ENSG00000128564
Vega: OTTHUMG00000157109
Pharos: O15240(Tbio)
UniProt: O15240
Position
7q22.1
AA seq 615 aa AA seqDB search
MKALRLSASALFCLLLINGLGAAPPGRPEAQPPPLSSEHKEPVAGDAVPGPKDGSAPEVR
GARNSEPQDEGELFQGVDPRALAAVLLQALDRPASPPAPSGSQQGPEEEAAEALLTETVR
SQTHSLPAPESPEPAAPPRPQTPENGPEASDPSEELEALASLLQELRDFSPSSAKRQQET
AAAETETRTHTLTRVNLESPGPERVWRASWGEFQARVPERAPLPPPAPSQFQARMPDSGP
LPETHKFGEGVSSPKTHLGEALAPLSKAYQGVAAPFPKARRPESALLGGSEAGERLLQQG
LAQVEAGRRQAEATRQAAAQEERLADLASDLLLQYLLQGGARQRGLGGRGLQEAAEERES
AREEEEAEQERRGGEERVGEEDEEAAEAEAEAEEAERARQNALLFAEEEDGEAGAEDKRS
QEETPGHRRKEAEGTEEGGEEEDDEEMDPQTIDSLIELSTKLHLPADDVVSIIEEVEEKR
KRKKNAPPEPVPPPRAAPAPTHVRSPQPPPPAPAPARDELPDWNEVLPPWDREEDEVYPP
GPYHPFPNYIRPRTLQPPSALRRRHYHHALPPSRHYPGREAQARRAQEEAEAEERRLQEQ
EELENYIEHVLLRRP
NT seq 1848 nt NT seq  +upstreamnt  +downstreamnt
atgaaagccctcagattgtcggcttccgccctcttctgccttctgctgatcaacgggtta
ggggcagcaccccctggtcgccctgaggcgcagcctcctcctctcagctctgagcataaa
gagccggtagccggggacgcagtgcccgggccaaaggatggcagcgccccagaggtccga
ggcgctcggaattccgagccgcaggacgagggagagcttttccagggcgtggatccccgg
gcgctggccgcggtgctgctgcaggcactcgaccgtcccgcctcacccccggcaccaagc
ggctcccagcaggggccggaggaagaagcagctgaagctctgctgaccgagaccgtgcgc
agccagacccacagcctcccggcgccggagagcccggagcccgcggctccgcctcgccct
cagactccggagaatgggcccgaggcgagcgatccctccgaggagctcgaggcgctagcg
tccctgctccaggaactgcgagatttcagtccaagtagcgccaagcgccagcaggagacg
gcggcagcagagacggaaacccgcacgcacacgctgacccgagtgaatctggagagcccg
gggccagagcgcgtatggcgcgcttcctggggagagttccaggcgcgtgtcccggagcgc
gcgcccctgccgcccccggccccctctcaattccaggcgcgtatgcccgacagcgggccc
cttcccgaaacccacaagttcggggaaggagtgtcctcccccaaaacacacctaggcgag
gcattggcacccctgtccaaggcgtaccaaggcgtggccgccccgttccccaaggcgcgc
cggccggagagcgcactcctgggcggctccgaggcgggcgagcgccttctccagcaaggg
ctggcgcaggtggaggccgggcggcggcaggcggaggccacgcggcaggccgcggcgcag
gaagagcggctggccgacctcgcctcggacctgctgctccagtatttgctgcagggcggg
gcccggcagcgcggcctcgggggtcgggggctgcaggaggcggcggaggagcgagagagt
gcaagggaggaggaggaggcggagcaggagagacgcggcggggaggagagggtgggggaa
gaggatgaggaggcggccgaggcggaggcagaggcggaggaggcggagagggcgcggcag
aacgcgctcctgttcgcggaggaggaggacggggaagccggcgccgaggacaagcgctcc
caggaggagacgccgggccaccggcggaaggaggccgaggggacagaggagggcggggag
gaggaggacgacgaggagatggatccgcagacgatcgacagcctcattgagctgtccacc
aaactccacctgccagcggacgacgtggtcagcatcatcgaggaggtggaggagaagcgg
aagcggaagaagaacgcccctcccgagcccgtgccgcccccccgtgccgcccccgccccc
acccacgtccgctccccgcagcccccgccccccgcccccgctcccgcacgagacgagctg
ccggactggaacgaggtgctcccgccctgggatcgggaggaggacgaggtgtacccgcca
gggccgtaccaccctttccccaactacatccggccgcggacactgcagccgccctcggcc
ttgcgccgccgccactaccaccacgccttgccgccttcgcgccactatcccggccgggag
gcccaggcgcggcgcgcgcaggaggaggcggaggcggaggagcgccggctgcaggagcag
gaggagctggagaattacatcgagcacgtgctgctccggcgcccgtga

DBGET integrated database retrieval system