KEGG   Homo sapiens (human): 79006Help
Entry
79006             CDS       T01001                                 

Gene name
METRN, C16orf23, c380A1.2
Definition
(RefSeq) meteorin, glial cell differentiation regulator
Organism
hsa  Homo sapiens (human)
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 79006
NCBI-ProteinID: NP_076947
OMIM: 610998
HGNC: 14151
Ensembl: ENSG00000103260
Vega: OTTHUMG00000047851
Pharos: Q9UJH8(Tbio)
UniProt: Q9UJH8
Position
16p13.3
AA seq 293 aa AA seqDB search
MGFPAAALLCALCCGLLAPAARAGYSEERCSWRGSGLTQEPGSVGQLALACAEGAVEWLY
PAGALRLTLGGPDPRARPGIACLRPVRPFAGAQVFAERAGGALELLLAEGPGPAGGRCVR
WGPRERRALFLQATPHQDISRRVAAFRFELREDGRPELPPQAHGLGVDGACRPCSDAELL
LAACTSDFVIHGIIHGVTHDVELQESVITVVAARVLRQTPPLFQAGRSGDQGLTSIRTPL
RCGVHPGPGTFLFMGWSRFGEARLGCAPRFQEFRRAYEAARAAHLHPCEVALH
NT seq 882 nt NT seq  +upstreamnt  +downstreamnt
atggggttcccggccgcggcgctgctctgcgcgctgtgctgcggcctcctggccccggct
gcccgcgccggctactccgaggagcgctgcagctggaggggcagcggcctcacccaggag
cccggcagcgtggggcagctggccctggcctgtgcggagggcgcggttgagtggctgtac
ccggctggggcgctgcgcctgaccctgggcggccccgatcccagagcgcggcccggcatc
gcctgtctgcggccggtgcggcccttcgcgggcgcccaggtcttcgcggagcgcgcaggg
ggcgccctggagctgctgctggccgagggcccgggcccggcagggggccgctgcgtgcgc
tggggtccccgcgagcgccgggccctcttcctgcaggccacgccgcaccaggacatcagc
cgccgcgtggccgccttccgctttgagctgcgcgaggacgggcgccccgagctgcccccg
caggcccacggtctcggcgtagacggtgcctgcaggccctgcagcgacgctgagctgctc
ctggccgcatgcaccagcgacttcgtaattcacgggatcatccatggggtcacccatgac
gtggagctgcaggagtctgtcatcactgtggtggccgcccgtgtcctccgccagacaccg
ccgctgttccaggcggggcgatccggggaccaggggctgacctccattcgtaccccactg
cgctgtggcgtccacccgggcccaggcaccttcctcttcatgggctggagccgctttggg
gaggcccggctgggctgtgccccacgattccaggagttccgccgtgcctacgaggctgcc
cgtgctgcccacctccacccctgcgaggtggcgctgcactga

DBGET integrated database retrieval system