KEGG   Homo sapiens (human): 83755Help
Entry
83755             CDS       T01001                                 

Gene name
KRTAP4-12, KAP4.12, KRTAP4.12
Definition
(RefSeq) keratin associated protein 4-12
Organism
hsa  Homo sapiens (human)
SSDB OrthologParalogGFIT
Motif
Pfam: Keratin_B2_2 Keratin_B2
Motif
Other DBs
NCBI-GeneID: 83755
NCBI-ProteinID: NP_114060
HGNC: 16776
Ensembl: ENSG00000213416
Vega: OTTHUMG00000133632
Pharos: Q9BQ66(Tdark)
UniProt: Q9BQ66
Position
17q21.2
AA seq 201 aa AA seqDB search
MVNSCCGSVCSDQGCGLENCCRPSCCQTTCCRTTCCRPSCCVSSCCRPQCCQSVCCQPTC
CRPSCCQTTCCRTTCCRPSCCVSSCCRPQCCQSVCCQPTCCRPSCCQTTCCRTTCCRPSC
CVSSCCRPQCCQSVCCQPTCCRPSCCISSSCCPSCCESSCCRPCCCLRPVCGRVSCHTTC
YRPTCVISTCPRPLCCASSCC
NT seq 606 nt NT seq  +upstreamnt  +downstreamnt
atggtcaactcctgttgtggctctgtgtgctctgaccagggctgtggcctggagaactgc
tgccgccccagctgctgccagaccacctgctgcaggaccacctgctgccgccccagctgc
tgtgtgtccagctgctgcaggccccagtgctgccagtctgtgtgctgtcagcccacctgc
tgccgccccagctgctgtcagaccacctgctgtaggaccacctgctgccgccccagctgc
tgtgtgtccagctgctgcagaccccagtgctgccagtctgtgtgctgccagcccacctgc
tgccgccccagctgctgtcagaccacctgctgcaggaccacttgctgccgccccagctgc
tgtgtgtccagctgctgcagaccccagtgctgccagtctgtgtgctgccagcccacctgc
tgccgccccagctgctgcatctccagcagctgctgcccctcttgctgtgaatccagctgc
tgccgcccctgctgctgcctgcgtccagtctgtggccgagtctcctgccacaccacttgc
tatcgcccaacctgtgtcatctccacctgcccccgccccttgtgctgtgcctcctcttgc
tgctaa

DBGET integrated database retrieval system