KEGG   Homo sapiens (human): 83902Help
Entry
83902             CDS       T01001                                 

Gene name
KRTAP17-1, KAP17.1, KRTAP16.1, KRTAP17.1
Definition
(RefSeq) keratin associated protein 17-1
Organism
hsa  Homo sapiens (human)
SSDB OrthologParalogGFIT
Motif
Pfam: Keratin_B2_2
Motif
Other DBs
NCBI-GeneID: 83902
NCBI-ProteinID: NP_114170
HGNC: 18917
Ensembl: ENSG00000186860
Vega: OTTHUMG00000133433
Pharos: Q9BYP8(Tdark)
UniProt: Q9BYP8
Position
17q21.2
AA seq 105 aa AA seqDB search
MGCCPGDCFTCCTQEQNCCEECCCQPGCCGCCGSCCGCGGSGCGGSGCGGSCCGSSCCGS
GCGGCGGCGGCGGGCCGSSCCGSSCCGSGCCGPVCCQPTPICDTK
NT seq 318 nt NT seq  +upstreamnt  +downstreamnt
atggggtgctgcccgggggactgcttcacctgctgcacccaggagcaaaactgctgtgaa
gagtgctgctgtcagccgggctgctgtggctgctgcggctcctgctgtggctgtgggggc
tctggctgcgggggctctggctgcgggggcagctgctgcggatcgtcttgctgtggatct
ggctgcggaggctgtggaggctgcggaggctgcgggggtggctgctgtggatccagttgc
tgtgggtccagttgctgcggctccgggtgctgtgggcctgtgtgctgccagcccacacct
atatgcgacacaaaatga

DBGET integrated database retrieval system