KEGG   Homo sapiens (human): 85495
Entry
85495             ncRNA     T01001                                 
Symbol
RPPH1, H1RNA, RPPH1-1
Name
(RefSeq) ribonuclease P RNA component H1
Organism
hsa  Homo sapiens (human)
SSDB
Other DBs
NCBI-GeneID: 85495
OMIM: 608513
HGNC: 19273
Ensembl: ENSG00000277209
Position
14:complement(20343071..20343411)
NT seq 341 nt   +upstreamnt  +downstreamnt
atagggcggagggaagctcatcagtggggccacgagctgagtgcgtcctgtcactccact
cccatgtcccttgggaaggtctgagactagggccagaggcggccctaacagggctctccc
tgagcttcggggaggtgagttcccagagaacggggctccgcgcgaggtcagactgggcag
gagatgccgtggaccccgcccttcggggaggggcccggcggatgcctcctttgccggagc
ttggaacagactcacggccagcgaagtgagttcaatggctgaggtgaggtaccccgcagg
ggacctcataacccaattcagactactctcctccgcccatt

DBGET integrated database retrieval system