KEGG   Homo sapiens (human): 8870
Entry
8870              CDS       T01001                                 

Gene name
IER3, DIF-2, DIF2, GLY96, IEX-1, IEX-1L, IEX1, PRG1
Definition
(RefSeq) immediate early response 3
Organism
hsa  Homo sapiens (human)
SSDB
Other DBs
NCBI-GeneID: 8870
NCBI-ProteinID: NP_003888
OMIM: 602996
HGNC: 5392
Ensembl: ENSG00000137331
Vega: OTTHUMG00000031265
Pharos: P46695(Tbio)
UniProt: P46695 A0A1U9X7X2
Position
6p21.33
AA seq 156 aa
MCHSRSCHPTMTILQAPTPAPSTIPGPRRGSGPEIFTFDPLPEPAAAPAGRPSASRGHRK
RSRRVLYPRVVRRQLPVEEPNPAKRLLFLLLTIVFCQILMAEEGVPAPLPPEDAPNAASL
APTPVSAVLEPFNLTSEPSDYALDLSTFLQQHPAAF
NT seq 471 nt   +upstreamnt  +downstreamnt
atgtgtcactctcgcagctgccacccgaccatgaccatcctgcaggccccgaccccggcc
ccctccaccatcccgggaccccggcggggctccggtcctgagatcttcaccttcgaccct
ctcccggagcccgcagcggcccctgccgggcgccccagcgcctctcgcgggcaccgaaag
cgcagccgcagggttctctaccctcgagtggtccggcgccagctgccagtcgaggaaccg
aacccagccaaaaggcttctctttctgctgctcaccatcgtcttctgccagatcctgatg
gctgaagagggtgtgccggcgcccctgcctccagaggacgcccctaacgccgcatccctg
gcgcccacccctgtgtccgccgtcctcgagccctttaatctgacttcggagccctcggac
tacgctctggacctcagcactttcctccagcaacacccggccgccttctaa

DBGET integrated database retrieval system