KEGG   Homo sapiens (human): 9083Help
Entry
9083              CDS       T01001                                 

Gene name
BPY2, BPY2A, VCY2, VCY2A
Definition
(RefSeq) basic charge Y-linked 2
Organism
hsa  Homo sapiens (human)
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 9083
NCBI-ProteinID: NP_004669
OMIM: 400013
HGNC: 13508
Ensembl: ENSG00000183753
Vega: OTTHUMG00000058899
Pharos: O14599(Tbio)
UniProt: O14599
Position
Yq11.223
AA seq 106 aa AA seqDB search
MMTLVPRARTRAGQDHYSHPCPRFSQVLLTEGIMTYCLTKNLSDVNILHRLLKNGNVRNT
LLQSKVGLLTYYVKLYPGEVTLLTRPSIQMRLCCITGSVSRPRSQK
NT seq 321 nt NT seq  +upstreamnt  +downstreamnt
atgatgacgcttgtccccagagccaggacacgtgcaggacaggatcattactctcatccc
tgccccagattttcacaggtgctgcttacagagggcatcatgacatattgcttgacaaag
aacctaagtgatgttaatattctgcataggttgctaaaaaatgggaatgtgagaaatacc
ttgcttcagtccaaagtgggcttgctgacatattatgtgaaactgtacccgggtgaagtg
actcttctgactaggcccagcatacaaatgagattatgctgtatcactggctcagtgtcg
aggcccagatcacagaagtaa

DBGET integrated database retrieval system