KEGG   Kineococcus radiotolerans: Krad_1184Help
Entry
Krad_1184         CDS       T00562                                 

Definition
(GenBank) hypothetical protein
Organism
kra  Kineococcus radiotolerans
SSDB OrthologParalogGene clusterGFIT
Motif
Pfam: Zn-ribbon_8 Rad50_zn_hook
Motif
Other DBs
NCBI-ProteinID: ABS02672
UniProt: A6W783
Position
1068429..1068674
Genome map
AA seq 81 aa AA seqDB search
MPVRTTGPPAGRGGPARTAVRRRTTRGGTMAEIWSGEFYCVKCKEKREAEGQVVETNGRR
MAKGKCPVCDTNLNRILGKAS
NT seq 246 nt NT seq  +upstreamnt  +downstreamnt
atgccggtcaggaccaccggcccgccggcgggccggggtggcccagcgcggaccgccgtc
cggaggcgaacgacacgaggaggcaccatggccgagatctggagcggggagttctactgc
gtgaagtgcaaggagaagcgcgaggcggagggccaggtcgtggagaccaacggccgccgg
atggcgaaggggaagtgccccgtgtgcgacaccaacctcaaccgcatcctcggcaaggcg
tcctga

DBGET integrated database retrieval system