KEGG   Kineococcus radiotolerans: Krad_1274Help
Entry
Krad_1274         CDS       T00562                                 

Definition
(GenBank) anti-sigma-factor antagonist
Organism
kra  Kineococcus radiotolerans
SSDB OrthologParalogGene clusterGFIT
Motif
Pfam: STAS_2 STAS
Motif
Other DBs
NCBI-ProteinID: ABS02762
UniProt: A6W7H3
Position
complement(969173..969784)
Genome map
AA seq 203 aa AA seqDB search
MRNPPAVPCVRPVTITTITTGSSGEEHMAIGIAAAPTTELVAPSTADDVAARRAARSTPG
QGASVHEEVPGQVLHLVGRLDVRTVPDVRSALHTAVDAGRGELVVHVGGIVVADATGLGV
LVGAHRRAQRIGRRLVLRDVPLPALRLLRVTKLHRVLQVEDEVADPAQRTALRRARAEAL
LRPRETAAQNSRASTSSMPLRAS
NT seq 612 nt NT seq  +upstreamnt  +downstreamnt
gtgcgcaacccgccggcggtgccctgcgtcagaccggtgacgatcacgacgatcacgacc
ggctcctcgggggaggaacacatggcgatcggaatcgcagcagcaccgacgaccgagctc
gtcgcgcccagcaccgccgacgacgtggccgcgcgccgcgccgcgcgctccacacccggc
cagggcgcgagcgtgcacgaggaggtgcccgggcaggtcctgcacctggtgggccgcctc
gacgtgcgcaccgtgcccgacgtgcgctccgcgctgcacaccgcggtcgacgcggggcgg
ggtgagctcgtcgtccacgtcggcgggatcgtcgtcgccgacgcgaccggcctgggggtg
ctcgtgggcgcccaccggcgcgcgcagcggatcgggcgccggctcgtcctgcgcgacgtc
ccgctgcccgccctgcggctgctgcgggtcaccaagctgcaccgggtcctgcaggtggag
gacgaggtcgccgaccccgcccagcgcaccgcgctgcgccgggcccgggccgaggccctc
ctgcggccccgggagaccgccgctcagaacagccgggcgtccacgtcgtcgatgcccctc
agggcgtcgtag

DBGET integrated database retrieval system