KEGG   Kitasatospora setae: KSE_75860tHelp
Entry
KSE_75860t        CDS       T01648                                 

Definition
(GenBank) putative maltokinase
  KO
K16146  maltokinase [EC:2.7.1.175]
Organism
ksk  Kitasatospora setae
Pathway
ksk00500  Starch and sucrose metabolism
ksk01100  Metabolic pathways
Brite
KEGG Orthology (KO) [BR:ksk00001]
 09100 Metabolism
  09101 Carbohydrate metabolism
   00500 Starch and sucrose metabolism
    KSE_75860t
Enzymes [BR:ksk01000]
 2. Transferases
  2.7  Transferring phosphorus-containing groups
   2.7.1  Phosphotransferases with an alcohol group as acceptor
    2.7.1.175  maltokinase
     KSE_75860t
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: BAJ33339
NITE: KSE_75860t
UniProt: E4N408
Position
8681318..8682751
Genome map
AA seq 477 aa AA seqDB search
MSGQPLPFERAATERALTAWLPSQRWYAGRTRPLDHVSVIAAHPFGGPPGPRRGPARGLL
LVARAHFADAGAPEHYQVPIGIRPALPGPRPQDPPPIAVIGDTVVHDALADHALVRDLLA
PPAPDGAPTPLALRAENTTPGHRPPAGPPATSRLLTAEQSNTSVVIDDRYLLKCFRRLHT
GPNPEVELRRALAGHPGPPLTPPLHAVLHGHLGEAPVTYAVLQSYLPDAVDGWTAALHHL
RTRPGQSFARDAHAMGTATGAVHTRLAAAFGTRRPTPGEAARLTARLLTALEDALRAVPE
LARHETALRHAYAQAADPTPATTLQRVHGDLHLGQLVRCGRTWQLIDFEGEPSAPMAERT
APRPPLADIAGMLRSFDYAAHHAAWQPGPADPRDLRRWARDSQHAFCDGYALATGHDPRD
TPAPLRAHILAKAVYESAYEARNRPHWLHIPLEDVERLLDPAAWPPHRPPGDDTPWN
NT seq 1434 nt NT seq  +upstreamnt  +downstreamnt
gtgagcggccagcccctgcccttcgagcgcgccgccacggaacgggccctcaccgcctgg
ctgccctcacaacgctggtacgcgggaaggacccgccccctcgaccacgtgtccgtcatc
gccgcgcaccccttcggcggcccgcccggcccccgccgcggcccggcccgcggactcctc
ctggtggcccgcgcccacttcgccgacgcgggcgcccccgagcactaccaggtgcccatc
ggcatccgccccgccctgcccggcccccgcccccaggacccgccccccatcgccgtcatc
ggcgacaccgtcgtccacgacgccctcgccgaccacgcgctcgtccgcgacctcctcgcg
ccgccggccccagacggcgcccccacccccctcgccctgcgcgccgagaacaccaccccc
ggccaccggccccccgccggcccgcccgccaccagcagactcctcaccgccgaacagagc
aacacctccgtcgtcatcgacgaccgctacctcctcaagtgcttccgccgcctgcacacc
ggccccaaccccgaggtcgaactgcgccgcgccctggccggccaccccggcccgcccctc
accccgcccctgcacgccgtcctccacggccacctcggcgaagcccccgtcacctacgcc
gtcctgcagagctacctgcccgacgccgtcgacggatggaccgccgccctgcaccacctc
cgaacccgacccggacagtccttcgcccgcgacgcccacgccatgggaacagccaccggc
gccgtccacacccgcctcgccgccgccttcggcacccgccgccccacccccggcgaagcc
gcccgcctcaccgcgcgcctgctcaccgcactggaggacgccctgcgcgccgtccccgaa
ctggcccgccacgaaaccgccctgcgccacgcctacgcccaggccgccgaccccaccccc
gccaccaccctccaacgcgtccacggcgacctccacctcggccagctcgtccgctgcggc
cgcacctggcagctcatcgacttcgaaggggaaccctccgccccgatggccgagcgcacc
gccccccgccccccgctcgccgacatcgccggcatgctccgctccttcgactacgccgcc
caccacgccgcctggcaacccggccccgccgacccgcgggacctgcgccgctgggcccgg
gacagccagcacgccttctgcgacggctacgccctggccaccggccacgacccccgcgac
acccccgcaccgctgcgcgcccacatcctcgccaaagccgtctacgagagcgcctacgaa
gcccgcaaccgcccgcactggctgcacataccgctggaagacgtcgaacggctcctcgac
cccgcggcatggccgccgcaccggccccccggagatgacaccccatggaactga

DBGET integrated database retrieval system