KEGG   Candidatus Liberibacter asiaticus psy62: CLIBASIA_02005Help
Entry
CLIBASIA_02005    CDS       T00948                                 

Definition
(GenBank) type II restriction endonuclease
Organism
las  Candidatus Liberibacter asiaticus psy62
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: ACT56987
UniProt: C6XF35
Position
complement(763546..763878)
Genome map
AA seq 110 aa AA seqDB search
MQFNEIILKNISNNYEVPKMLITELSTELFNLKTANQNFFHNTLTKKFGDYMSKITPYLY
EWVLSNTQSRRSRDGQEFEYIIYSLYNINTFVTHLMHKKKSGKALSLSIM
NT seq 333 nt NT seq  +upstreamnt  +downstreamnt
atgcaattcaatgaaataatactcaagaatattagtaataattatgaagtgccgaaaatg
ctaatcactgagttgagcactgaactatttaatcttaaaactgctaatcaaaattttttt
cataatactttaactaagaaatttggggattatatgagcaaaattaccccatatttatat
gaatgggttctcagcaatacacaatctagaagatctagggatggacaagaatttgaatac
attatctattccctgtataatataaacaccttcgttacccatttgatgcacaaaaagaag
tcgggaaaagcactttcgctaagtataatgtag

DBGET integrated database retrieval system