KEGG   Candidatus Liberibacter asiaticus psy62: CLIBASIA_02010Help
Entry
CLIBASIA_02010    CDS       T00948                                 

Definition
(GenBank) hypothetical protein
Organism
las  Candidatus Liberibacter asiaticus psy62
SSDB OrthologParalogGene clusterGFIT
Motif
Pfam: EcoRII-C
Motif
Other DBs
NCBI-ProteinID: ACT56988
UniProt: C6XF36
Position
complement(763285..763413)
Genome map
AA seq 42 aa AA seqDB search
MPTIHLLTVDSEIAENKAERIDKHNIILVVLDKVKKEKHLKE
NT seq 129 nt NT seq  +upstreamnt  +downstreamnt
atgcctactatccatcttctaactgttgattctgaaattgcagaaaacaaagctgaacga
atagataaacacaacatcattttagtggttttagataaggtaaaaaaagaaaagcatttg
aaggaatga

DBGET integrated database retrieval system