KEGG   Candidatus Liberibacter asiaticus psy62: CLIBASIA_t05767Help
Entry
CLIBASIA_t05767   tRNA      T00948                                 

Definition
(GenBank) tRNA-Cys
  KO
K14222  tRNA Cys
Organism
las  Candidatus Liberibacter asiaticus psy62
Pathway
las00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:las00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    CLIBASIA_t05767
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:las03100]
    CLIBASIA_t05767
Non-coding RNAs [BR:las03100]
 Transfer RNA
  tRNA
   CLIBASIA_t05767
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
complement(919580..919653)
Genome map
NT seq 74 nt NT seq  +upstreamnt  +downstreamnt
ggcctcgtggcggaatggttacgcagaggactgcaaatccttcaaccccagttcgattct
gggcgaggcctcca

DBGET integrated database retrieval system