KEGG   Lactobacillus delbrueckii subsp. bulgaricus ND02: LDBND_tRNA090Help
Entry
LDBND_tRNA090     tRNA      T01360                                 

Definition
(GenBank) tRNA-Glu
  KO
K14224  tRNA Glu
Organism
lde  Lactobacillus delbrueckii subsp. bulgaricus ND02
Pathway
lde00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:lde00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    LDBND_tRNA090
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:lde03100]
    LDBND_tRNA090
Non-coding RNAs [BR:lde03100]
 Transfer RNA
  tRNA
   LDBND_tRNA090
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
complement(633244..633315)
Genome map
NT seq 72 nt NT seq  +upstreamnt  +downstreamnt
cacccgttggtcaagtggttaagacgctaccctctcaaggtggagtcatgagttcaattc
tcgtacgggtga

DBGET integrated database retrieval system