KEGG   Lotus japonicus: Lj0g3v0060769.1Help
Entry
Lj0g3v0060769.1   CDS       T04348                                 

Gene name
Lj0g3v0060769.1
Definition
(Kazusa) -
  KO
K06210  nicotinamide mononucleotide adenylyltransferase [EC:2.7.7.1 2.7.7.18]
Organism
lja  Lotus japonicus
Pathway
lja00760  Nicotinate and nicotinamide metabolism
lja01100  Metabolic pathways
Module
lja_M00115  NAD biosynthesis, aspartate => NAD
Brite
KEGG Orthology (KO) [BR:lja00001]
 09100 Metabolism
  09108 Metabolism of cofactors and vitamins
   00760 Nicotinate and nicotinamide metabolism
    Lj0g3v0060769.1 (Lj0g3v0060769.1)
Enzymes [BR:lja01000]
 2. Transferases
  2.7  Transferring phosphorus-containing groups
   2.7.7  Nucleotidyltransferases
    2.7.7.1  nicotinamide-nucleotide adenylyltransferase
     Lj0g3v0060769.1 (Lj0g3v0060769.1)
    2.7.7.18  nicotinate-nucleotide adenylyltransferase
     Lj0g3v0060769.1 (Lj0g3v0060769.1)
BRITE hierarchy
SSDB OrthologParalogGFIT
AA seq 98 aa AA seqDB search
MVDPWEANQSSYQRTLTVLSTVHSSICETGLVSREFLKVMLVCGSDLLHSFGTPGFWIRD
QEKTICRDFGFGVVCIRREGQDVEKTICDDEILNENQG
NT seq 300 nt NT seq  +upstreamnt  +downstreamnt
atggttgatccatgggaggcaaatcaaagctcatatcagcgcactttaactgttctctcc
acagtccacagttctatttgtgagacagggttggtatctagagaattcctcaaggtcatg
cttgtttgtggttctgatctcctccattcttttggcactcctggattctggattcgtgac
caggaaaagactatatgcagagattttggatttggagtagtctgcattcgcagagaagga
caagatgtggagaaaactatatgcgatgatgaaattttgaatgagaatcagggatgaaaa

DBGET integrated database retrieval system