KEGG   Listeria monocytogenes SLCC2479 (serotype 3c): LMOSLCC2479tRNA10Help
Entry
LMOSLCC2479tRNA10 tRNA      T02241                                 

Gene name
tRNA-Ala_(TGC)
Definition
(GenBank) tRNA-Ala
  KO
K14218  tRNA Ala
Organism
lmoy  Listeria monocytogenes SLCC2479 (serotype 3c)
Pathway
lmoy00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:lmoy00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    LMOSLCC2479tRNA10 (tRNA-Ala_(TGC))
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:lmoy03100]
    LMOSLCC2479tRNA10 (tRNA-Ala_(TGC))
Non-coding RNAs [BR:lmoy03100]
 Transfer RNA
  LMOSLCC2479tRNA10 (tRNA-Ala_(TGC))
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
243105..243177
Genome map
NT seq 73 nt NT seq  +upstreamnt  +downstreamnt
ggggccttagctcagctgggagagcgcctgctttgcacgcaggaggtcagcggttcgatc
ccgctaggctcca

DBGET integrated database retrieval system