KEGG   Listeria monocytogenes 08-5923 (serotype 1/2a): LM5923_tRNA06Help
Entry
LM5923_tRNA06     tRNA      T01164                                 

Definition
(GenBank) tRNA-Ser
  KO
K14233  tRNA Ser
Organism
lmy  Listeria monocytogenes 08-5923 (serotype 1/2a)
Pathway
lmy00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:lmy00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    LM5923_tRNA06
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:lmy03100]
    LM5923_tRNA06
Non-coding RNAs [BR:lmy03100]
 Transfer RNA
  tRNA
   LM5923_tRNA06
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
939415..939502
Genome map
NT seq 88 nt NT seq  +upstreamnt  +downstreamnt
ggggaagtactcaagtggctgaagaggtgcccctgctaagggtataggtcgctcgcgcgg
cgcgagggttcaaatccctccttctccg

DBGET integrated database retrieval system